ID: 1087603042

View in Genome Browser
Species Human (GRCh38)
Location 11:100339915-100339937
Sequence CTGGGGGTAGGGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2014
Summary {0: 1, 1: 1, 2: 19, 3: 211, 4: 1782}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087603042 Original CRISPR CTGGGGGTAGGGAGGGTGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr