ID: 1087603324

View in Genome Browser
Species Human (GRCh38)
Location 11:100343502-100343524
Sequence CTGAGGAGAATCCAAACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087603324_1087603329 -5 Left 1087603324 11:100343502-100343524 CCCAGAGTTTGGATTCTCCTCAG 0: 1
1: 0
2: 1
3: 17
4: 169
Right 1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG 0: 1
1: 0
2: 1
3: 1
4: 46
1087603324_1087603333 30 Left 1087603324 11:100343502-100343524 CCCAGAGTTTGGATTCTCCTCAG 0: 1
1: 0
2: 1
3: 17
4: 169
Right 1087603333 11:100343555-100343577 GAAAGCTCCTCCTGACACAATGG 0: 1
1: 0
2: 1
3: 10
4: 111
1087603324_1087603331 5 Left 1087603324 11:100343502-100343524 CCCAGAGTTTGGATTCTCCTCAG 0: 1
1: 0
2: 1
3: 17
4: 169
Right 1087603331 11:100343530-100343552 GGGTTTTCACAGGGCAGCCAAGG 0: 1
1: 0
2: 1
3: 24
4: 239
1087603324_1087603330 -4 Left 1087603324 11:100343502-100343524 CCCAGAGTTTGGATTCTCCTCAG 0: 1
1: 0
2: 1
3: 17
4: 169
Right 1087603330 11:100343521-100343543 TCAGAACGCGGGTTTTCACAGGG 0: 1
1: 0
2: 0
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087603324 Original CRISPR CTGAGGAGAATCCAAACTCT GGG (reversed) Intronic
904853744 1:33479378-33479400 GGGATCAGAATCCAAACTCTGGG + Exonic
906911500 1:49956722-49956744 CTCATGGGATTCCAAACTCTGGG - Intronic
906941593 1:50260400-50260422 CTCACCAGAATGCAAACTCTCGG - Intergenic
906948030 1:50312260-50312282 CTGACCAGAATTCAGACTCTTGG - Intergenic
911083610 1:93957788-93957810 TTGGGTAGAATCCAAATTCTTGG + Intergenic
912572482 1:110634684-110634706 CTGAGGAGCACCCAAGCCCTTGG - Intergenic
916153461 1:161820222-161820244 CTGAGGAGATTAAAACCTCTTGG - Intronic
919246905 1:194999849-194999871 CTTAAGAAAATCAAAACTCTTGG - Intergenic
919382223 1:196873506-196873528 TTGAGCAGAATCCAGTCTCTTGG - Intronic
919992300 1:202716736-202716758 CTGAAGAAAATCCAAACAGTTGG - Intergenic
921922567 1:220685843-220685865 CTGAGGAGAAACCAAACCCACGG + Intergenic
1062988255 10:1790227-1790249 CTGAGGATAGTCCAGGCTCTGGG - Intergenic
1063679260 10:8171608-8171630 CAGATGAGAAAACAAACTCTAGG - Intergenic
1063726046 10:8638600-8638622 TTGAGCAGAATCCTTACTCTTGG + Intergenic
1063931474 10:11032659-11032681 CCCAGTAGAGTCCAAACTCTTGG + Intronic
1064223371 10:13460582-13460604 CTGAGGGGCATCCAAACACGGGG - Intronic
1069531140 10:69220410-69220432 CTCAGGAGAAACCAAACTTGGGG + Exonic
1069748713 10:70732306-70732328 CTGAGGAGAAGCCATCCTCATGG - Exonic
1070405323 10:76089478-76089500 TTGAGGAGAATCTGAGCTCTTGG + Intronic
1070725489 10:78784999-78785021 CTATGGAGATTCTAAACTCTTGG - Intergenic
1071399521 10:85255992-85256014 CTGAGGAGTCTGCAAACACTGGG - Intergenic
1071732325 10:88260672-88260694 ATGAGGAGAATACAAATTCAAGG - Intergenic
1072054937 10:91745531-91745553 CTGAGCAGAAACCCAACTCTAGG + Intergenic
1075071696 10:119324210-119324232 CTGAGCAGAATCCAGACCCTGGG - Intronic
1077719569 11:4614170-4614192 GTGAGGAGAAGCAAAAATCTGGG - Intergenic
1077751479 11:4975228-4975250 GTGAGGATCTTCCAAACTCTAGG - Intronic
1078829643 11:14967501-14967523 CAGAGATGAATCCAAATTCTAGG + Intronic
1080723823 11:34875052-34875074 CTGTGGGGCAGCCAAACTCTGGG + Intronic
1083544224 11:63537164-63537186 CTGAGGAGAAGCCAGAGTGTGGG + Intronic
1085985539 11:81782955-81782977 CTTAGCAGAATCCAAAATATTGG + Intergenic
1087603324 11:100343502-100343524 CTGAGGAGAATCCAAACTCTGGG - Intronic
1088763448 11:112953665-112953687 CTGAGCTGAATTCAAACTCCAGG - Intergenic
1088881929 11:113979407-113979429 ATGAGGAGATTCCACACTCCTGG - Intronic
1089432811 11:118437018-118437040 TTGAGGAGCATCCCAATTCTGGG + Intronic
1090445453 11:126761167-126761189 CTGAGAAGAATGGAAACACTGGG + Intronic
1093746260 12:22744280-22744302 CTGAAGAGAAGCCAAAATATTGG - Intergenic
1093853939 12:24075686-24075708 CTGAGGAGCATTTAAACTTTGGG - Intergenic
1096584801 12:52613091-52613113 CTCAAGGGAATCCACACTCTTGG - Intronic
1097921989 12:65085897-65085919 CAGTGGTGATTCCAAACTCTAGG - Intronic
1100873982 12:98943265-98943287 CTGAGGATGTTCCAAACTCAAGG + Intronic
1104427073 12:128686766-128686788 CTCAGGAGAACCTAAACTCTAGG - Intronic
1106376234 13:29190930-29190952 CTGAGAAGATGCCATACTCTTGG + Intronic
1107280504 13:38728282-38728304 CTGAGCAGGATTAAAACTCTAGG + Intronic
1109855593 13:68123056-68123078 CTGTGGACAATCCAAACACATGG + Intergenic
1110230728 13:73164770-73164792 CTGAGTAGAATTCATACTCCTGG - Intergenic
1112118432 13:96383474-96383496 CTCAAGACAATCCAGACTCTAGG + Intronic
1113839836 13:113352920-113352942 CCCAGTAGAATCCACACTCTGGG + Intronic
1113839916 13:113353241-113353263 CCCAGCAGAATCCACACTCTGGG + Intronic
1116169810 14:41385834-41385856 CTGAGGAGACTGCAAACTTCAGG - Intergenic
1116889435 14:50253614-50253636 TTGAGGAGCCTCCAAACTATTGG - Intronic
1117493816 14:56280690-56280712 CTTAGGAGAATTCATATTCTTGG + Intronic
1117636818 14:57753299-57753321 CAGAGGAGAATCTAATCACTGGG - Intronic
1117643013 14:57820413-57820435 CTCTGGAGAATTCTAACTCTTGG - Intronic
1118648617 14:67866087-67866109 ATTAGCAGAATCCAAACTGTGGG + Intronic
1119738553 14:76999392-76999414 CTGAGGAGAAGCCAATGTCTGGG + Intergenic
1122374757 14:101250418-101250440 CAGAGGAGACTCCACACTCAGGG + Intergenic
1123155619 14:106222386-106222408 CTCAGGAGAATCAAGGCTCTAGG - Intergenic
1123402278 15:19999506-19999528 CTCAGGAGAATCAAGGCTCTAGG - Intergenic
1123511618 15:21006172-21006194 CTCAGGAGAATCAAGGCTCTAGG - Intergenic
1124490852 15:30154163-30154185 CTGAGGGGAAGACAACCTCTGGG - Intergenic
1124995635 15:34720706-34720728 CTGAGGTGAGCTCAAACTCTTGG + Intergenic
1128713727 15:69891739-69891761 CTGAGGAGAATCTGGATTCTGGG - Intergenic
1130702880 15:86203163-86203185 CTGAGGGGAATCCAAAAGTTGGG + Intronic
1132488208 16:208475-208497 CTGAGGAAAATTAAAACACTTGG + Intronic
1134484237 16:14644587-14644609 CTGAGGAGAATACTGACTTTGGG - Exonic
1139704620 16:68732656-68732678 CTGGGGAAAACCCAAACTCCAGG - Intergenic
1140918408 16:79514521-79514543 CTTAGGAAAATCAAAGCTCTGGG - Intergenic
1144655821 17:17035854-17035876 CTGAGGATAATACTAATTCTGGG + Intergenic
1145107977 17:20136010-20136032 CTGAGAAGAAGCCAAACTCTAGG + Intronic
1145239474 17:21231753-21231775 CTGAGCAGCAGCCAAACCCTCGG - Intergenic
1146967268 17:37043093-37043115 CTGATGAGAATACAGACTATTGG - Intronic
1149545937 17:57504098-57504120 TGGAGGAGAAACCAAAGTCTGGG - Intronic
1151375934 17:73689171-73689193 CTGAGGAGACCCCATTCTCTAGG + Intergenic
1151431439 17:74066227-74066249 CTGGGGAAAATCCAAATTTTTGG + Intergenic
1151696006 17:75717910-75717932 CTGAGGAGAAAACAAACCCCAGG + Intergenic
1153306991 18:3640518-3640540 CTGAGGAGAAACCAAGCACGTGG + Intronic
1156469536 18:37368670-37368692 CTGAGGTGACCCCAAACCCTGGG - Intronic
1156612069 18:38736603-38736625 CTGAGGATAATAAAAAATCTTGG - Intergenic
1156706630 18:39890282-39890304 CTGATGAAAATCCAAAGTGTGGG - Intergenic
1159591368 18:70338798-70338820 CTGAAGACACTCCCAACTCTTGG - Intronic
1159819445 18:73121154-73121176 CTAAGGAGAATGCTGACTCTTGG - Intergenic
1161177489 19:2854827-2854849 TTGAGAAAAATCCAGACTCTAGG - Exonic
1165197797 19:34118719-34118741 CTGTGGAGAAGTCAAACTGTAGG - Intergenic
1165966491 19:39585101-39585123 CTGAGGAGATTCTACACTTTGGG - Intergenic
1166151765 19:40880295-40880317 CTGAGGAGAATCAGAATTCCAGG + Intronic
925265364 2:2563126-2563148 GTGAGGAGAAGGCACACTCTAGG - Intergenic
925545567 2:5012206-5012228 CTGTGGAGAATAGAAATTCTGGG + Intergenic
926707507 2:15847074-15847096 CTGAGGAGCATCAATACTCCTGG - Intergenic
928792939 2:34980732-34980754 GTCATGAGAATCCAAAATCTAGG + Intergenic
928824888 2:35408126-35408148 CTGAGGATATTCCAAAGACTTGG - Intergenic
929815049 2:45223782-45223804 CTGAGGAGACTCCCAAGGCTAGG + Intergenic
930245503 2:48979564-48979586 CTGGGGAGGAACCAAACTCCTGG - Intronic
931275269 2:60738744-60738766 CTGAGGAGACTCCAACAGCTAGG + Intergenic
937560334 2:123216011-123216033 TTGAGAAGAAACCAAATTCTAGG - Intergenic
937584163 2:123525771-123525793 CTAAGGAGTAGCCAAACCCTTGG - Intergenic
938587628 2:132707181-132707203 GTGTGGAGAATCCACACTCTTGG + Intronic
939226231 2:139368330-139368352 CTGAGGCAAGTACAAACTCTAGG + Intergenic
939534255 2:143406330-143406352 CTGAAAAGAATCCATTCTCTTGG - Intronic
941326109 2:164116563-164116585 CTAAGTAGAAGACAAACTCTAGG + Intergenic
941628864 2:167862102-167862124 CTCTGGAGAATCCTAACTATAGG - Intergenic
942994110 2:182240151-182240173 CTGAGGAAAAACCAAAATTTCGG - Exonic
944140726 2:196453195-196453217 TTGCAGAGAACCCAAACTCTTGG - Intronic
945528915 2:210925848-210925870 CTGTGGTGAATCCAAAGTCATGG + Intergenic
946783498 2:223218115-223218137 CTGAGAAGAAGCCACACTATTGG + Intergenic
947111101 2:226720594-226720616 CTTAGGAAAATACCAACTCTTGG + Intergenic
947134223 2:226961071-226961093 CTGAGGGGAATACAGATTCTAGG - Intronic
948152448 2:235755053-235755075 CTGCTGAGAATCCAAACGGTTGG - Intronic
1170615111 20:17942112-17942134 CTGGGCAGAATCCAAATACTGGG - Exonic
1170703983 20:18728270-18728292 CTGACCAGAAGCCAAACTCAGGG - Intronic
1175047531 20:56121237-56121259 ATGTGGAGAAACCAAACTCTTGG - Intergenic
1179069294 21:38056650-38056672 CTGAGGGGACTCCACACACTGGG - Intronic
1179791257 21:43757240-43757262 CTGGGGGGACCCCAAACTCTGGG - Exonic
1180600458 22:17012091-17012113 CTGAGGAAAAAACAAACACTTGG - Intergenic
1182064828 22:27423268-27423290 CTGTGGAGAATCCAGGCTCTAGG - Intergenic
1184129699 22:42510522-42510544 CTGAGGAGAAACCAAAGCCTGGG - Exonic
1184139855 22:42572327-42572349 CTGAGGAGAAACCAAAGCCTGGG - Intronic
952763286 3:36934265-36934287 CTGAGAAGAAGCCAATTTCTGGG + Intronic
953476827 3:43212329-43212351 CTGAGAAAAATCCAAGCTCTAGG - Intergenic
954848905 3:53583611-53583633 CTGAGGAGAGTCCCACCTCGTGG - Intronic
956982439 3:74654497-74654519 CAGAGGAGAGTCCAACCGCTGGG + Intergenic
958600952 3:96296267-96296289 CTGAGGAGATACCAAATTCCTGG - Intergenic
959988898 3:112608312-112608334 CTAAGGAGAAGCTAAAATCTAGG + Intronic
962444991 3:135456162-135456184 CTGATGAGAATCGAAACGCTTGG + Intergenic
968290464 3:197535174-197535196 TTGAGGAGAATGCAAACATTCGG + Intronic
968326842 3:197824911-197824933 CTGAGGAAGATCCAGAGTCTAGG - Intronic
968574827 4:1360746-1360768 CTGCGGAGAAAGCTAACTCTGGG - Intronic
970059383 4:12013829-12013851 CTGTGGAGAATCCAAAATATTGG + Intergenic
970233748 4:13937810-13937832 CTCAGGAGAATGGAAACTCCTGG - Intergenic
971919888 4:32924417-32924439 CTGAATAGAATTTAAACTCTGGG - Intergenic
973804981 4:54516838-54516860 CTGGGGAGAAGCCAATCTCATGG + Intergenic
974747862 4:66099737-66099759 CTGTGGTGAATCCAAAGTCCAGG - Intergenic
974818729 4:67039254-67039276 CTGAGGAGAATGAAAATTTTGGG - Intergenic
975942737 4:79667754-79667776 ATGTGAAGAATCCAAATTCTAGG + Intergenic
981295525 4:143126625-143126647 GGAAGGAGAATCTAAACTCTTGG - Intergenic
983219294 4:165029165-165029187 ATTAGTAAAATCCAAACTCTTGG + Intergenic
984638490 4:182140240-182140262 CTGAGCAAAACCCAAATTCTAGG - Intergenic
984895288 4:184533669-184533691 CTGATGAGAATACATACTCATGG + Intergenic
988732642 5:33988362-33988384 CTGAGGAGAAATCAAACACATGG + Exonic
997750590 5:136341736-136341758 TCAAGGAGAAACCAAACTCTTGG + Intronic
998242561 5:140462048-140462070 ATCAGGAAAATCCATACTCTGGG - Intronic
999725072 5:154430320-154430342 ATGTGGAGAATCCAAAGCCTAGG - Intergenic
1000706888 5:164523691-164523713 CTGAGGAGAGTCAAATATCTGGG + Intergenic
1003237597 6:4310584-4310606 CTGAAGAGAATCTCAAATCTTGG + Intergenic
1007847459 6:44771736-44771758 CTGAGGAGAATCCACAGGCAGGG + Intergenic
1010184497 6:73127390-73127412 CTTAGGAGATTCCAAGCTCTGGG - Intronic
1010895918 6:81363962-81363984 CTGACAAGAATCCAAAGTCTTGG + Intergenic
1012108127 6:95192102-95192124 CTAAGGAGAAACAAAAGTCTTGG + Intergenic
1013412596 6:109894846-109894868 AGGAGGATACTCCAAACTCTTGG + Intergenic
1016065700 6:139680985-139681007 CTGAGGAAAATCCCAGCACTGGG + Intergenic
1017547375 6:155467138-155467160 TTGAGGAGAATCCATATTCTTGG + Intergenic
1022962106 7:35437248-35437270 GGGATGAGTATCCAAACTCTAGG + Intergenic
1023201577 7:37703569-37703591 CAGAATTGAATCCAAACTCTGGG + Intronic
1023922725 7:44642065-44642087 CTTTGGAGATTCCAAACCCTGGG + Intronic
1025239066 7:57256611-57256633 CAGGGGAGAATCCCAACTCGAGG - Intergenic
1025719789 7:63999306-63999328 CAGGGGAGAATCCAGACTCAGGG + Intergenic
1027968720 7:85048377-85048399 ATAAGGACAATCCAAACTCAGGG + Intronic
1029401177 7:100347522-100347544 GTGAGAAGAAACCAAACTCGAGG + Intronic
1029668156 7:102009138-102009160 CTGGCTACAATCCAAACTCTGGG - Intronic
1031504772 7:122568748-122568770 CAGAGGAGAATTCCAACTTTGGG + Intronic
1032687479 7:134250092-134250114 CTGTGGAGCATCCAAACGCATGG + Intronic
1035494822 7:159315458-159315480 ATGAGCATACTCCAAACTCTTGG + Intergenic
1039059605 8:33563199-33563221 TTGAGAACAAGCCAAACTCTAGG - Intronic
1039197771 8:35051474-35051496 CCTAGGAGAATTCAAACTCTAGG - Intergenic
1040683181 8:49838213-49838235 CTGAGAAGCAGACAAACTCTTGG - Intergenic
1042126678 8:65544989-65545011 CTCAGTAGAATGCAAACTCGAGG - Intergenic
1043536149 8:81206785-81206807 CTGAGAAGAACCAGAACTCTAGG + Intergenic
1044910686 8:97055168-97055190 TTGTGGAGAATCCAGACCCTAGG - Intronic
1045638266 8:104218361-104218383 ATGAGGAGAATGCAAACTGCTGG - Intronic
1046324420 8:112621759-112621781 CTGAGAAGAAGCCAAGCCCTGGG - Intronic
1046973277 8:120246145-120246167 CTGAGCAGAATCAGGACTCTGGG - Intronic
1047045623 8:121049617-121049639 GTGAAGAGAGACCAAACTCTAGG + Intergenic
1047289438 8:123516535-123516557 CAGAGGAGAATGGAAACTTTTGG + Intronic
1049252530 8:141596904-141596926 GTGAGGGGAATCCAGACTCCAGG - Intergenic
1055742462 9:79404854-79404876 ATGGGGTGAATACAAACTCTGGG - Intergenic
1055772075 9:79728126-79728148 GGGAGGGGAATCCAAGCTCTCGG - Intergenic
1059556197 9:115282808-115282830 CTGAGCATCCTCCAAACTCTAGG + Intronic
1062178634 9:135178711-135178733 CTGGGGAGATTCCAAATGCTGGG + Intergenic
1186494869 X:10004872-10004894 CTTAAGAGAATCAAAACTGTAGG - Intergenic
1186516041 X:10166759-10166781 CTGGGGAAATTCCAAACCCTTGG + Intronic
1186721557 X:12309948-12309970 ATGAGTAGAATCCAATCTGTGGG - Intronic
1189001661 X:36954395-36954417 AGGAGCAGACTCCAAACTCTTGG + Intergenic
1189738056 X:44091469-44091491 CTCAGGTGAATCAGAACTCTGGG - Intergenic
1192303307 X:69929650-69929672 CTGAGCAGAATCTACACTCCAGG - Intronic
1195105262 X:101597372-101597394 CTGAGGATAAGCCAAGCCCTGGG + Intergenic
1195718199 X:107839327-107839349 CTGACAAGAAACCAACCTCTTGG - Intronic
1195903578 X:109822957-109822979 CTGAGGACTATGTAAACTCTGGG + Intergenic
1196918544 X:120562842-120562864 CAGAGTAGACTCCAAATTCTTGG - Intronic
1199621556 X:149705922-149705944 ATGGGGAGAATGCTAACTCTAGG - Intronic