ID: 1087603325

View in Genome Browser
Species Human (GRCh38)
Location 11:100343503-100343525
Sequence TCTGAGGAGAATCCAAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 172}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087603325_1087603329 -6 Left 1087603325 11:100343503-100343525 CCAGAGTTTGGATTCTCCTCAGA 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG 0: 1
1: 0
2: 1
3: 1
4: 46
1087603325_1087603330 -5 Left 1087603325 11:100343503-100343525 CCAGAGTTTGGATTCTCCTCAGA 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1087603330 11:100343521-100343543 TCAGAACGCGGGTTTTCACAGGG 0: 1
1: 0
2: 0
3: 2
4: 53
1087603325_1087603333 29 Left 1087603325 11:100343503-100343525 CCAGAGTTTGGATTCTCCTCAGA 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1087603333 11:100343555-100343577 GAAAGCTCCTCCTGACACAATGG 0: 1
1: 0
2: 1
3: 10
4: 111
1087603325_1087603334 30 Left 1087603325 11:100343503-100343525 CCAGAGTTTGGATTCTCCTCAGA 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1087603334 11:100343556-100343578 AAAGCTCCTCCTGACACAATGGG 0: 1
1: 0
2: 0
3: 9
4: 107
1087603325_1087603331 4 Left 1087603325 11:100343503-100343525 CCAGAGTTTGGATTCTCCTCAGA 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1087603331 11:100343530-100343552 GGGTTTTCACAGGGCAGCCAAGG 0: 1
1: 0
2: 1
3: 24
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087603325 Original CRISPR TCTGAGGAGAATCCAAACTC TGG (reversed) Intronic
905765107 1:40593974-40593996 ACTGAAGAGAATGCAAACACAGG - Intergenic
907787986 1:57632639-57632661 TGTGAGGAGAAGGGAAACTCAGG + Intronic
911783901 1:101920259-101920281 TCTGAGTAAAATCCAAAGTCAGG + Intronic
911860965 1:102948367-102948389 TCAGAGTAGAGTCCAAGCTCAGG - Intronic
916356679 1:163917479-163917501 CCTGAGGAGCATGGAAACTCAGG - Intergenic
917218727 1:172704819-172704841 TATGAGGAGAATGAAAGCTCTGG - Intergenic
919463016 1:197901523-197901545 TCTGAGGAGAGTTTAAAATCTGG - Intergenic
920646377 1:207807117-207807139 TCTCAGGTGAAACCTAACTCTGG + Intergenic
920971763 1:210749028-210749050 CCTGGGGAGAATTCAAACTGGGG - Intronic
922420896 1:225460608-225460630 TCTGAGCAGAATGCAACCTTTGG - Intergenic
923149540 1:231220880-231220902 TCTGAGGAGAGGCCAAAACCAGG + Intronic
923727101 1:236515911-236515933 TGACAGGAGAATCCAAATTCAGG - Intergenic
1064223372 10:13460583-13460605 GCTGAGGGGCATCCAAACACGGG - Intronic
1064683719 10:17837183-17837205 TCTGAGGTGAACCCAGCCTCTGG - Intronic
1065686233 10:28288020-28288042 TGTGAAGAAAATCCAACCTCAGG - Intronic
1066707584 10:38198188-38198210 TATGATGAAAATACAAACTCAGG - Intergenic
1067406100 10:46024908-46024930 TCTCTGGAGAACCCTAACTCAGG - Intronic
1067896161 10:50182025-50182047 CATGAGGAGAATACAACCTCTGG - Intergenic
1067952817 10:50759976-50759998 CATGAGGAGAATACAACCTCTGG + Intronic
1069531139 10:69220409-69220431 TCTCAGGAGAAACCAAACTTGGG + Exonic
1075071697 10:119324211-119324233 CCTGAGCAGAATCCAGACCCTGG - Intronic
1076012656 10:127002939-127002961 AGTGAGGAGAAGCCACACTCTGG - Intronic
1077496351 11:2888394-2888416 TCCGAGGAGAATGCAAAGGCTGG - Exonic
1078629425 11:12988982-12989004 TCTGAGGAAATACCCAACTCAGG + Intergenic
1081262427 11:40977155-40977177 TCTGACAAGAATCAGAACTCAGG + Intronic
1085296498 11:75434540-75434562 TCTGAGGAGGAACCATTCTCAGG - Intergenic
1085559148 11:77454270-77454292 CAGGATGAGAATCCAAACTCTGG + Intronic
1086139655 11:83482208-83482230 TATGAGGAGTATCAATACTCAGG + Intronic
1087603325 11:100343503-100343525 TCTGAGGAGAATCCAAACTCTGG - Intronic
1088465795 11:110136882-110136904 TCTGAAGAGAATGCAAGCTCTGG + Exonic
1090445452 11:126761166-126761188 TCTGAGAAGAATGGAAACACTGG + Intronic
1091639901 12:2228518-2228540 TCTTAGGAGAACGAAAACTCAGG - Intronic
1092084690 12:5746315-5746337 TTTGAGGAGAATCCATACCATGG - Intronic
1098816079 12:75164125-75164147 TTTGAGAAGAATACAGACTCAGG + Intronic
1099980760 12:89599116-89599138 TCTGAACAGAATCCAAACACAGG - Exonic
1100850996 12:98710925-98710947 TCAAAGTAGAATCCAAATTCAGG + Intronic
1102076486 12:110064200-110064222 TATGAGCAGAATTCAAATTCAGG - Intronic
1104795336 12:131513280-131513302 TCTGAGAACAATCCCAACACAGG - Intergenic
1106129863 13:26931332-26931354 CCTGACCAGAATCCAACCTCAGG - Intergenic
1106275324 13:28199606-28199628 TCTGTGTAGATTCCAAACTGGGG + Intronic
1106865572 13:33960388-33960410 TCTGCGGAGAAGCTAGACTCGGG - Intronic
1107418272 13:40221390-40221412 TCTGTGGAGAATCCAGGCCCAGG - Intergenic
1109474526 13:62861862-62861884 TCTGTGGAAAATCAAACCTCTGG + Intergenic
1111581212 13:90226086-90226108 GCTGAGGAAAAACCAAGCTCAGG + Intergenic
1111607700 13:90562340-90562362 TGAGAGGAAAATACAAACTCAGG + Intergenic
1113146647 13:107215364-107215386 TCAGCTGAGAATCCAAACACAGG - Intronic
1113427609 13:110222287-110222309 TCTGGAGAAAACCCAAACTCTGG + Intronic
1116073032 14:40073656-40073678 TCTGTGGAGCATAGAAACTCAGG + Intergenic
1116981562 14:51176204-51176226 TCTCAGGAGAGCCCAAACTAAGG + Intergenic
1119436703 14:74602075-74602097 TCTGTGGGGATTCCACACTCTGG + Intronic
1119738552 14:76999391-76999413 CCTGAGGAGAAGCCAATGTCTGG + Intergenic
1122374756 14:101250417-101250439 GCAGAGGAGACTCCACACTCAGG + Intergenic
1122948861 14:105029524-105029546 TCGGGAGAGAAGCCAAACTCAGG + Intergenic
1123971794 15:25514569-25514591 ACTGAGTAGACTCCAAGCTCAGG - Intergenic
1124490853 15:30154164-30154186 TCTGAGGGGAAGACAACCTCTGG - Intergenic
1125952447 15:43764317-43764339 TATAAGGAGAATCTAAACTGAGG + Intronic
1129481863 15:75832920-75832942 TTTTAGGAGAACCCAAACTAAGG + Intergenic
1129649724 15:77475462-77475484 TCTGAGGAGAGTCAAGACTTTGG + Intronic
1135199870 16:20428163-20428185 TGTGAGGAGAAGCCTATCTCAGG - Intronic
1135218830 16:20595447-20595469 TGTGAGGAGAAGCCTATCTCAGG + Intergenic
1135707420 16:24686803-24686825 TAGGAGGGGAATCCAAACGCAGG - Intergenic
1137482781 16:48866088-48866110 TCTCAGCAGCATCCAAACTCAGG - Intergenic
1143770526 17:9165582-9165604 TCTGAGTAGAATCCATCCTTAGG - Intronic
1144402843 17:14923061-14923083 TCTGAGGAGTTTCCAGACTTAGG - Intergenic
1149268827 17:54955089-54955111 TCTGAGGGGCTTCCAAACTCTGG + Intronic
1149869769 17:60170936-60170958 TCTGAGCAGGATTCAAACCCAGG - Intergenic
1153765485 18:8370719-8370741 TCTGAGAAGAATAAAAACACAGG + Intronic
1156530866 18:37813859-37813881 TCTCTGGAGAATCCTAACACAGG + Intergenic
1156533041 18:37836363-37836385 TCTAAGGAGAATGCAAAGTAAGG + Intergenic
1156578848 18:38351705-38351727 TCTCAGTACAATCCATACTCTGG - Intergenic
1156670408 18:39462381-39462403 TCTGAAGAGAAAACAAACTAAGG + Intergenic
1159594042 18:70365517-70365539 TCTGATGAGAAGCCAAGTTCTGG + Intergenic
1160480133 18:79232386-79232408 TCTGAGGAAAGCCCAAAGTCAGG + Intronic
1160695111 19:480099-480121 CCAGAGGAGAAGCCGAACTCGGG + Intergenic
1163581791 19:18143869-18143891 TCTGATGAGAAGGCAAACTTGGG - Exonic
1163870978 19:19821275-19821297 TCAGGGGAGAATCCTGACTCGGG - Intronic
1163875006 19:19860737-19860759 TCAGGGGAGAATCCTGACTCAGG - Intergenic
1163884689 19:19955359-19955381 TCAGGGGAGAATCCTGACTCGGG - Intergenic
1163898267 19:20078427-20078449 TCGGGGGAGAATCCTGACTCGGG + Intronic
1163915559 19:20237959-20237981 TCAGGGGAGAATCCTGACTCGGG - Intergenic
1163948779 19:20565311-20565333 TCAGGGGAGAATCCTGACTCGGG - Intronic
1163983523 19:20923704-20923726 TCAGGGGAGAATCCTGACTCGGG + Intronic
1164048949 19:21567798-21567820 TCAGGGGAGAATCCCGACTCGGG - Intergenic
1164100842 19:22052941-22052963 TCAGGGGAGAATCCTGACTCGGG + Intronic
1164123256 19:22286858-22286880 TCAGGGGAGAATCCTGACTCCGG + Intronic
1164162262 19:22634783-22634805 TCAGGGGAGAATCCTGACTCGGG + Intronic
1164176926 19:22783689-22783711 TCAGGGGAGAATCCTGACTCCGG - Intronic
1164182634 19:22832683-22832705 TCAGGGGAGAATCCTGACTCGGG + Intergenic
1164213139 19:23117478-23117500 TCAGAGGAGAATCCTGACTCGGG + Intronic
1164226375 19:23249912-23249934 TCAGGGGAGAATCCTGACTCGGG - Intronic
1164315899 19:24087628-24087650 TCAGGGGAGAATCCTGACTCGGG + Intronic
1168662872 19:58182011-58182033 ACTGTGGAGGATCCAACCTCAGG - Intergenic
926206193 2:10835645-10835667 TCAGAGGTGGATCCAAACCCAGG - Intronic
926624694 2:15081345-15081367 GCTCAGGAGAAACTAAACTCAGG + Intergenic
929610917 2:43270066-43270088 CCTGAGAATAATCCAGACTCGGG - Intronic
930372683 2:50523965-50523987 TCTTAGAAGAATAAAAACTCTGG - Intronic
931462224 2:62458896-62458918 TTTGAGGAGAAACTAAATTCTGG + Intergenic
932532343 2:72549375-72549397 TCTGATGAGAATCTGAACTAGGG + Intronic
932718572 2:74121546-74121568 TCTGAGGAGAAGGCAAACCAGGG + Intergenic
939950387 2:148465132-148465154 TATGAGGAAAATCCAAACTGAGG - Intronic
943258769 2:185630758-185630780 ACTGAGAAGAATGCAAACTGGGG - Intergenic
944185457 2:196943190-196943212 TCTTAGGAGAATGCAAACCTTGG + Intergenic
944631006 2:201624304-201624326 TCTGAGGAGAACATTAACTCTGG + Exonic
946877277 2:224141947-224141969 TTTGAAGAGAAACCAACCTCTGG + Intergenic
1170615112 20:17942113-17942135 TCTGGGCAGAATCCAAATACTGG - Exonic
1170703984 20:18728271-18728293 ACTGACCAGAAGCCAAACTCAGG - Intronic
1170778481 20:19402032-19402054 TCTGGGGAGAACCCAAAATAAGG + Intronic
1173095440 20:40023414-40023436 TCTGAGTAGAATTCATTCTCTGG + Intergenic
1174396500 20:50250217-50250239 TCAAAGGAAAATCCACACTCAGG + Intergenic
1177330383 21:19652544-19652566 TCTGGGAAGAATCCAAATTAAGG + Intergenic
1177417986 21:20818904-20818926 TCTGAGGAGCATCCCAAATGGGG + Intergenic
1177549113 21:22597995-22598017 CCTGAGGAGAATTCAAACGCAGG - Intergenic
1179407223 21:41136173-41136195 TGTGGGGGGAATCCAAACTAAGG + Intergenic
1181426125 22:22840818-22840840 TCTGTGGAGAATCCTAATACAGG - Intronic
1182584320 22:31335179-31335201 TCAGAAGAGAGCCCAAACTCAGG - Intronic
1184129700 22:42510523-42510545 TCTGAGGAGAAACCAAAGCCTGG - Exonic
1184139856 22:42572328-42572350 TCTGAGGAGAAACCAAAGCCTGG - Intronic
1184992438 22:48180092-48180114 TCTGAGGAGACTGGAAAGTCTGG - Intergenic
949801827 3:7912512-7912534 CCAGAGCAGAAGCCAAACTCAGG + Intergenic
952663852 3:35880409-35880431 TCTGAAGGAAATCCAAAGTCAGG - Intergenic
953811839 3:46119467-46119489 GCTGATGAGAATACAAAATCTGG + Intergenic
954018156 3:47713888-47713910 TTTGAGGAGAATCCAAAGGCAGG - Intronic
954345824 3:49998351-49998373 TCAGATGAGAAGCAAAACTCAGG - Intronic
956982438 3:74654496-74654518 TCAGAGGAGAGTCCAACCGCTGG + Intergenic
959464910 3:106673701-106673723 TCTGAGTAAAATGCCAACTCTGG + Intergenic
960892797 3:122468254-122468276 TCCAAGGAGCATCTAAACTCTGG - Intronic
962113795 3:132480085-132480107 TCTGAGGAAAAAACAACCTCTGG - Intronic
966119586 3:176507210-176507232 TCTGAGGACATTCCTAACTTAGG - Intergenic
968574828 4:1360747-1360769 TCTGCGGAGAAAGCTAACTCTGG - Intronic
970709341 4:18843384-18843406 TCTGAGTAGAGTCCACAATCTGG - Intergenic
971919889 4:32924418-32924440 TCTGAATAGAATTTAAACTCTGG - Intergenic
973284700 4:48402782-48402804 TTGGAGGAGAATACAAATTCTGG + Intronic
975028847 4:69587515-69587537 TCTGAAGAGAAACCAGACTTTGG - Intergenic
978403135 4:108351494-108351516 TCTGTGCAGAATCCAAAGTTGGG - Intergenic
978431882 4:108641199-108641221 TCTGAGGAGAATACACGCTATGG - Intergenic
979439629 4:120735804-120735826 GCTGAGGAGAACCCAGGCTCAGG + Intronic
981608388 4:146564971-146564993 TCTGGGTAGAGTCCAGACTCTGG - Intergenic
982885756 4:160780573-160780595 TCTGAGAAAAATACAAACTGAGG - Intergenic
983256291 4:165404348-165404370 TCTGAGGAGACTTCAGACTTAGG + Intronic
984707153 4:182855906-182855928 TCTCAAAAGATTCCAAACTCAGG - Intergenic
995765442 5:115611750-115611772 TCTCAGGAGTTTCCAAATTCTGG - Intronic
995874708 5:116778260-116778282 TCTGAGGAGGGTCCTTACTCTGG - Intergenic
996821533 5:127634165-127634187 TCTGTGAAGAATCTAAACTTGGG + Intergenic
997979212 5:138458695-138458717 TCAGAGGACAATCCAGCCTCTGG - Intergenic
1000267101 5:159648076-159648098 GCTGGGGAGAAACCAAAGTCAGG + Intergenic
1002644340 5:180645803-180645825 TCTGAAAAGGATCGAAACTCAGG + Intronic
1007766536 6:44163786-44163808 TCTGTGGAGAAGCAAAATTCAGG + Intronic
1007847458 6:44771735-44771757 GCTGAGGAGAATCCACAGGCAGG + Intergenic
1010184498 6:73127391-73127413 ACTTAGGAGATTCCAAGCTCTGG - Intronic
1013832749 6:114293932-114293954 TCAAAGGAGAAACCAAACTGTGG + Intronic
1014539299 6:122654213-122654235 CCTAAGAAGAATCCAAACCCTGG - Intronic
1016466601 6:144331779-144331801 TCTGAGGAAGAGCAAAACTCCGG - Intronic
1020972875 7:14968623-14968645 TGTAAGGAGAATCCAAACAATGG - Intronic
1023539530 7:41250742-41250764 TCTGAGCAGAGCCCAAACACTGG + Intergenic
1023922724 7:44642064-44642086 TCTTTGGAGATTCCAAACCCTGG + Intronic
1025222937 7:57131959-57131981 TCAGGGGAGAATCCTGACTCAGG - Intronic
1025633733 7:63303623-63303645 TCAGGGGAGAATCCTGACTCAGG - Intergenic
1025648963 7:63444545-63444567 TCAGGGGAGAATCCTGACTCAGG + Intergenic
1025719788 7:63999305-63999327 TCAGGGGAGAATCCAGACTCAGG + Intergenic
1025746771 7:64249458-64249480 TCAGGGGAGAATCCCGACTCAGG + Intronic
1025788591 7:64666626-64666648 TCAGGGGAGAATCCTGACTCGGG + Intronic
1025801965 7:64794863-64794885 TCAGGGGAGAATCCTGACTCGGG + Intronic
1026558407 7:71427798-71427820 TCTGATGAGAAGCCGAGCTCAGG - Intronic
1027968719 7:85048376-85048398 GATAAGGACAATCCAAACTCAGG + Intronic
1028425352 7:90681072-90681094 TAAGAGGAGAATTAAAACTCTGG - Intronic
1029668157 7:102009139-102009161 TCTGGCTACAATCCAAACTCTGG - Intronic
1030299032 7:107956786-107956808 TCTCAGGTGGTTCCAAACTCAGG + Intronic
1031052945 7:116963598-116963620 TCTGTGGAGAACCCTAACTTTGG + Intronic
1032625206 7:133584420-133584442 TCAGAGAAGACTCCCAACTCTGG - Intronic
1033919826 7:146376937-146376959 TCTGGGGAGAACCCAGTCTCTGG - Intronic
1034557439 7:151859062-151859084 CCTGAGGAGAAGCCAGACCCTGG + Intronic
1035702618 8:1648288-1648310 TCTGAGGACAATACTTACTCAGG + Intronic
1039532099 8:38271945-38271967 TCTGTAGAGAATACAATCTCTGG - Exonic
1039683901 8:39775441-39775463 TCTGTGTAGATTCCAATCTCTGG + Intronic
1042622951 8:70726036-70726058 TCTGAGCAGAATCCAATTTGAGG + Intronic
1042662619 8:71172159-71172181 ACTGAGGATTAACCAAACTCAGG - Intergenic
1044515702 8:93136027-93136049 ACTCAGTAGAACCCAAACTCAGG + Intronic
1045719706 8:105094099-105094121 TCTGTGGAGAATCCTAATACAGG - Intronic
1049297128 8:141847510-141847532 TCAGAGGAGTATCCAATATCAGG + Intergenic
1050157598 9:2683970-2683992 ACTGAAGATAATCCAAAATCAGG - Intergenic
1061067568 9:128288144-128288166 TCTGAGGAGAACCCTTCCTCAGG + Intronic
1062666916 9:137678885-137678907 TCTGAGTAGCATGCTAACTCTGG - Intronic
1187564720 X:20437502-20437524 TATGAGGAGAATCTAGACTCTGG + Intergenic
1189644666 X:43115027-43115049 TCTGAGGAATATCCAACATCTGG - Intergenic
1190284564 X:48953652-48953674 TCTGTGGGGTCTCCAAACTCAGG + Intronic
1194599598 X:95903952-95903974 TCTGAGGGGAATACAAGATCAGG + Intergenic
1194608060 X:96005994-96006016 TCTTGGGAGAGTCCAAACTTGGG + Intergenic