ID: 1087603329

View in Genome Browser
Species Human (GRCh38)
Location 11:100343520-100343542
Sequence CTCAGAACGCGGGTTTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087603325_1087603329 -6 Left 1087603325 11:100343503-100343525 CCAGAGTTTGGATTCTCCTCAGA 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG 0: 1
1: 0
2: 1
3: 1
4: 46
1087603324_1087603329 -5 Left 1087603324 11:100343502-100343524 CCCAGAGTTTGGATTCTCCTCAG 0: 1
1: 0
2: 1
3: 17
4: 169
Right 1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG 0: 1
1: 0
2: 1
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087603329 Original CRISPR CTCAGAACGCGGGTTTTCAC AGG Intronic