ID: 1087603329

View in Genome Browser
Species Human (GRCh38)
Location 11:100343520-100343542
Sequence CTCAGAACGCGGGTTTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087603324_1087603329 -5 Left 1087603324 11:100343502-100343524 CCCAGAGTTTGGATTCTCCTCAG 0: 1
1: 0
2: 1
3: 17
4: 169
Right 1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG 0: 1
1: 0
2: 1
3: 1
4: 46
1087603325_1087603329 -6 Left 1087603325 11:100343503-100343525 CCAGAGTTTGGATTCTCCTCAGA 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG 0: 1
1: 0
2: 1
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087603329 Original CRISPR CTCAGAACGCGGGTTTTCAC AGG Intronic
911856082 1:102877231-102877253 CTCAGAATCCAGGATTTCACAGG - Exonic
1063309582 10:4939713-4939735 CTCAGAATGAGTGTGTTCACTGG + Intronic
1063317716 10:5022388-5022410 CTCAGAATGAGTGTGTTCACTGG - Intronic
1065114921 10:22476143-22476165 GTCCGAACGCAGGGTTTCACTGG - Intergenic
1073056509 10:100706739-100706761 CTCAGAAAGAGGGGTGTCACTGG + Intergenic
1078894154 11:15583388-15583410 CTCATAACAGGGGGTTTCACTGG + Intergenic
1080819574 11:35792586-35792608 CCCAGAAGGAGGGATTTCACTGG - Intronic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1093479947 12:19593994-19594016 CTCTGAACGCAGGTTTTCTGTGG - Intronic
1094720085 12:33054063-33054085 CTCTGACGGCGGATTTTCACTGG - Intergenic
1100176384 12:92035598-92035620 CTCAAAACTCTGCTTTTCACAGG - Intronic
1113508472 13:110832628-110832650 TCCAGAACCCTGGTTTTCACGGG - Intergenic
1114179840 14:20356875-20356897 CTCAGAAGGCGGAAATTCACAGG + Intronic
1125243752 15:37609124-37609146 CTCAGAAAGGGAGTTTTCTCAGG - Intergenic
1130104439 15:80918863-80918885 CTCAGAACTCAGGTCTTCAGAGG - Intronic
1140093140 16:71853310-71853332 CTCAGACCGTGGGGTTCCACTGG + Exonic
1151365999 17:73616953-73616975 ATGAGAGGGCGGGTTTTCACAGG + Intronic
1154337913 18:13480877-13480899 GCCAGGACGTGGGTTTTCACTGG - Intronic
1156107012 18:33675536-33675558 CCCTGAACTCTGGTTTTCACTGG - Intronic
1166865455 19:45833663-45833685 ATCAGAACACTGGTTTTCTCTGG + Intronic
1167561282 19:50227406-50227428 CTCACTACCAGGGTTTTCACTGG + Intronic
925076673 2:1022376-1022398 CTGAGAACGCAGGTCCTCACGGG - Intronic
929413388 2:41722531-41722553 CTCAGAATGAGGGGTTTCCCTGG + Intergenic
940373521 2:152927772-152927794 CTCAGAACACTGGAATTCACTGG - Intergenic
943351295 2:186799352-186799374 CTCAGGGCCCGGGTTCTCACTGG - Intergenic
945274561 2:207975298-207975320 TTCAAAACGTGGGTTTTCAATGG + Intronic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
953061856 3:39434367-39434389 CTCAGTCCTCAGGTTTTCACAGG + Intergenic
953624263 3:44557671-44557693 CTCAGAACACAGTATTTCACAGG - Intronic
955032448 3:55233987-55234009 CTCAGGAGGCTGGTTTTCAGAGG + Intergenic
959903980 3:111690559-111690581 CTCAGAACACTGGTCTTCAAGGG + Intronic
965810279 3:172584624-172584646 CTCAGAAAGCGGGTTCTCACTGG + Intergenic
988682954 5:33501967-33501989 CTCAGGGCCCGGGTTCTCACTGG - Intergenic
1000137856 5:158370210-158370232 CTCAGAAGCCTGGTTTTTACAGG + Intergenic
1003052657 6:2793759-2793781 GTAAGAAGGCGTGTTTTCACCGG - Intergenic
1003829664 6:9993838-9993860 CTGAGAACCAGGGTGTTCACTGG - Intronic
1012447595 6:99322539-99322561 TGCAGAAGGTGGGTTTTCACTGG - Intronic
1018231534 6:161680414-161680436 CTCAGAACTCGGCCATTCACAGG - Intronic
1019892116 7:3955136-3955158 CTCGGACGGCGAGTTTTCACTGG + Intronic
1019902047 7:4028596-4028618 CTCCAAACGTGTGTTTTCACTGG - Intronic
1035779469 8:2216453-2216475 AGCAGAACTCGGATTTTCACAGG + Intergenic
1036389212 8:8310116-8310138 CTCATAAAACGGCTTTTCACTGG - Intergenic
1038415486 8:27391912-27391934 CTCAGAGCCAGGGTTTTCACTGG + Intronic
1045184462 8:99823003-99823025 ATCAGAACACTGGTTTTCAAAGG - Intronic
1056674078 9:88658468-88658490 CTCAAAACCTGGGTTTTCAATGG + Intergenic
1060771068 9:126332622-126332644 CCCAGACCCCGGGCTTTCACTGG + Intronic
1185501528 X:600267-600289 CTCAGGACTCTGGTTTGCACAGG - Intergenic
1198087438 X:133294190-133294212 CTCAGAGCTCGTGATTTCACTGG + Intergenic
1201934937 Y:19400002-19400024 CTCAGAACTAGAGTATTCACAGG + Intergenic