ID: 1087607659

View in Genome Browser
Species Human (GRCh38)
Location 11:100395875-100395897
Sequence CTAGGGAACTGAGGTACCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087607659_1087607666 9 Left 1087607659 11:100395875-100395897 CCCTAGGTACCTCAGTTCCCTAG No data
Right 1087607666 11:100395907-100395929 CATAGCAAACAACCAATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087607659 Original CRISPR CTAGGGAACTGAGGTACCTA GGG (reversed) Intergenic