ID: 1087607660

View in Genome Browser
Species Human (GRCh38)
Location 11:100395876-100395898
Sequence CCTAGGGAACTGAGGTACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087607660_1087607666 8 Left 1087607660 11:100395876-100395898 CCTAGGTACCTCAGTTCCCTAGG No data
Right 1087607666 11:100395907-100395929 CATAGCAAACAACCAATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087607660 Original CRISPR CCTAGGGAACTGAGGTACCT AGG (reversed) Intergenic
No off target data available for this crispr