ID: 1087607662 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:100395884-100395906 |
Sequence | TCAGGACTCCTAGGGAACTG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1087607662_1087607666 | 0 | Left | 1087607662 | 11:100395884-100395906 | CCTCAGTTCCCTAGGAGTCCTGA | No data | ||
Right | 1087607666 | 11:100395907-100395929 | CATAGCAAACAACCAATAATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1087607662 | Original CRISPR | TCAGGACTCCTAGGGAACTG AGG (reversed) | Intergenic | ||