ID: 1087607664

View in Genome Browser
Species Human (GRCh38)
Location 11:100395893-100395915
Sequence TTTGCTATGTCAGGACTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087607664_1087607668 26 Left 1087607664 11:100395893-100395915 CCTAGGAGTCCTGACATAGCAAA No data
Right 1087607668 11:100395942-100395964 TTTGCAAAATGCAGTATCTTTGG No data
1087607664_1087607666 -9 Left 1087607664 11:100395893-100395915 CCTAGGAGTCCTGACATAGCAAA No data
Right 1087607666 11:100395907-100395929 CATAGCAAACAACCAATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087607664 Original CRISPR TTTGCTATGTCAGGACTCCT AGG (reversed) Intergenic