ID: 1087607666

View in Genome Browser
Species Human (GRCh38)
Location 11:100395907-100395929
Sequence CATAGCAAACAACCAATAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087607664_1087607666 -9 Left 1087607664 11:100395893-100395915 CCTAGGAGTCCTGACATAGCAAA No data
Right 1087607666 11:100395907-100395929 CATAGCAAACAACCAATAATAGG No data
1087607658_1087607666 12 Left 1087607658 11:100395872-100395894 CCTCCCTAGGTACCTCAGTTCCC No data
Right 1087607666 11:100395907-100395929 CATAGCAAACAACCAATAATAGG No data
1087607659_1087607666 9 Left 1087607659 11:100395875-100395897 CCCTAGGTACCTCAGTTCCCTAG No data
Right 1087607666 11:100395907-100395929 CATAGCAAACAACCAATAATAGG No data
1087607660_1087607666 8 Left 1087607660 11:100395876-100395898 CCTAGGTACCTCAGTTCCCTAGG No data
Right 1087607666 11:100395907-100395929 CATAGCAAACAACCAATAATAGG No data
1087607662_1087607666 0 Left 1087607662 11:100395884-100395906 CCTCAGTTCCCTAGGAGTCCTGA No data
Right 1087607666 11:100395907-100395929 CATAGCAAACAACCAATAATAGG No data
1087607663_1087607666 -8 Left 1087607663 11:100395892-100395914 CCCTAGGAGTCCTGACATAGCAA No data
Right 1087607666 11:100395907-100395929 CATAGCAAACAACCAATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087607666 Original CRISPR CATAGCAAACAACCAATAAT AGG Intergenic