ID: 1087607668

View in Genome Browser
Species Human (GRCh38)
Location 11:100395942-100395964
Sequence TTTGCAAAATGCAGTATCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087607667_1087607668 0 Left 1087607667 11:100395919-100395941 CCAATAATAGGAATAACTATGTT No data
Right 1087607668 11:100395942-100395964 TTTGCAAAATGCAGTATCTTTGG No data
1087607663_1087607668 27 Left 1087607663 11:100395892-100395914 CCCTAGGAGTCCTGACATAGCAA No data
Right 1087607668 11:100395942-100395964 TTTGCAAAATGCAGTATCTTTGG No data
1087607665_1087607668 17 Left 1087607665 11:100395902-100395924 CCTGACATAGCAAACAACCAATA No data
Right 1087607668 11:100395942-100395964 TTTGCAAAATGCAGTATCTTTGG No data
1087607664_1087607668 26 Left 1087607664 11:100395893-100395915 CCTAGGAGTCCTGACATAGCAAA No data
Right 1087607668 11:100395942-100395964 TTTGCAAAATGCAGTATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087607668 Original CRISPR TTTGCAAAATGCAGTATCTT TGG Intergenic