ID: 1087607905

View in Genome Browser
Species Human (GRCh38)
Location 11:100399427-100399449
Sequence TTAACTATTAATTCTATTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087607905_1087607906 -4 Left 1087607905 11:100399427-100399449 CCAAGAATAGAATTAATAGTTAA No data
Right 1087607906 11:100399446-100399468 TTAATGCTAAGTCAATAAAGAGG No data
1087607905_1087607907 0 Left 1087607905 11:100399427-100399449 CCAAGAATAGAATTAATAGTTAA No data
Right 1087607907 11:100399450-100399472 TGCTAAGTCAATAAAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087607905 Original CRISPR TTAACTATTAATTCTATTCT TGG (reversed) Intergenic
No off target data available for this crispr