ID: 1087608182

View in Genome Browser
Species Human (GRCh38)
Location 11:100402945-100402967
Sequence TTGAATATACAAATAGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087608177_1087608182 16 Left 1087608177 11:100402906-100402928 CCTCAAATTCTCCCATTTGAAGA No data
Right 1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG No data
1087608180_1087608182 4 Left 1087608180 11:100402918-100402940 CCATTTGAAGAATACTATATGGA No data
Right 1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG No data
1087608178_1087608182 5 Left 1087608178 11:100402917-100402939 CCCATTTGAAGAATACTATATGG No data
Right 1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087608182 Original CRISPR TTGAATATACAAATAGGCAA TGG Intergenic
No off target data available for this crispr