ID: 1087616174

View in Genome Browser
Species Human (GRCh38)
Location 11:100488931-100488953
Sequence TGTCACCCCTTTCCTAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087616174_1087616177 -3 Left 1087616174 11:100488931-100488953 CCTTTCCTAGGAAAGGGGTGACA No data
Right 1087616177 11:100488951-100488973 ACAGACGGCACCTGAAAAATCGG 0: 7
1: 876
2: 1720
3: 1058
4: 635
1087616174_1087616178 -2 Left 1087616174 11:100488931-100488953 CCTTTCCTAGGAAAGGGGTGACA No data
Right 1087616178 11:100488952-100488974 CAGACGGCACCTGAAAAATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087616174 Original CRISPR TGTCACCCCTTTCCTAGGAA AGG (reversed) Intergenic
No off target data available for this crispr