ID: 1087617318

View in Genome Browser
Species Human (GRCh38)
Location 11:100502763-100502785
Sequence CAGTTTTACATGAGTGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087617312_1087617318 10 Left 1087617312 11:100502730-100502752 CCCTCTTATGTGATTCAAATAAT No data
Right 1087617318 11:100502763-100502785 CAGTTTTACATGAGTGCAGGGGG No data
1087617313_1087617318 9 Left 1087617313 11:100502731-100502753 CCTCTTATGTGATTCAAATAATC No data
Right 1087617318 11:100502763-100502785 CAGTTTTACATGAGTGCAGGGGG No data
1087617311_1087617318 11 Left 1087617311 11:100502729-100502751 CCCCTCTTATGTGATTCAAATAA No data
Right 1087617318 11:100502763-100502785 CAGTTTTACATGAGTGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087617318 Original CRISPR CAGTTTTACATGAGTGCAGG GGG Intergenic
No off target data available for this crispr