ID: 1087618010

View in Genome Browser
Species Human (GRCh38)
Location 11:100510615-100510637
Sequence CTTCTAAGGAACCCTGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087618010_1087618013 22 Left 1087618010 11:100510615-100510637 CCATTTGCAGGGTTCCTTAGAAG No data
Right 1087618013 11:100510660-100510682 TTTACTTTCAGCTCTCCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087618010 Original CRISPR CTTCTAAGGAACCCTGCAAA TGG (reversed) Intergenic
No off target data available for this crispr