ID: 1087624940

View in Genome Browser
Species Human (GRCh38)
Location 11:100585477-100585499
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087624940_1087624945 -3 Left 1087624940 11:100585477-100585499 CCATCCTCTCTCTGCCTCTGCTT No data
Right 1087624945 11:100585497-100585519 CTTGGCCAAAGGCAAGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087624940 Original CRISPR AAGCAGAGGCAGAGAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr