ID: 1087632153

View in Genome Browser
Species Human (GRCh38)
Location 11:100662520-100662542
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087632153_1087632160 3 Left 1087632153 11:100662520-100662542 CCGTAGTCCCTCCTTATCCACGG No data
Right 1087632160 11:100662546-100662568 TTATGTTCCAAGATCCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087632153 Original CRISPR CCGTGGATAAGGAGGGACTA CGG (reversed) Intergenic
No off target data available for this crispr