ID: 1087632160

View in Genome Browser
Species Human (GRCh38)
Location 11:100662546-100662568
Sequence TTATGTTCCAAGATCCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087632156_1087632160 -4 Left 1087632156 11:100662527-100662549 CCCTCCTTATCCACGGGCATTAT No data
Right 1087632160 11:100662546-100662568 TTATGTTCCAAGATCCCCAGTGG No data
1087632157_1087632160 -5 Left 1087632157 11:100662528-100662550 CCTCCTTATCCACGGGCATTATG No data
Right 1087632160 11:100662546-100662568 TTATGTTCCAAGATCCCCAGTGG No data
1087632158_1087632160 -8 Left 1087632158 11:100662531-100662553 CCTTATCCACGGGCATTATGTTC No data
Right 1087632160 11:100662546-100662568 TTATGTTCCAAGATCCCCAGTGG No data
1087632153_1087632160 3 Left 1087632153 11:100662520-100662542 CCGTAGTCCCTCCTTATCCACGG No data
Right 1087632160 11:100662546-100662568 TTATGTTCCAAGATCCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087632160 Original CRISPR TTATGTTCCAAGATCCCCAG TGG Intergenic
No off target data available for this crispr