ID: 1087632373

View in Genome Browser
Species Human (GRCh38)
Location 11:100665434-100665456
Sequence GGCTGGTAATCCTGAGGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087632373_1087632380 23 Left 1087632373 11:100665434-100665456 CCTAGACCTCAGGATTACCAGCC No data
Right 1087632380 11:100665480-100665502 CAGTCTATTCTTAAAATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087632373 Original CRISPR GGCTGGTAATCCTGAGGTCT AGG (reversed) Intergenic
No off target data available for this crispr