ID: 1087634406

View in Genome Browser
Species Human (GRCh38)
Location 11:100687046-100687068
Sequence CCGCGCTTGCGCTCCGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087634406_1087634412 -9 Left 1087634406 11:100687046-100687068 CCAAGGCCGGAGCGCAAGCGCGG No data
Right 1087634412 11:100687060-100687082 CAAGCGCGGGGCTGCAGCGCGGG No data
1087634406_1087634427 30 Left 1087634406 11:100687046-100687068 CCAAGGCCGGAGCGCAAGCGCGG No data
Right 1087634427 11:100687099-100687121 TGCGGGCGGACGGGTGGGGCAGG No data
1087634406_1087634417 16 Left 1087634406 11:100687046-100687068 CCAAGGCCGGAGCGCAAGCGCGG No data
Right 1087634417 11:100687085-100687107 GCCCTGGAGCCCAGTGCGGGCGG No data
1087634406_1087634413 -8 Left 1087634406 11:100687046-100687068 CCAAGGCCGGAGCGCAAGCGCGG No data
Right 1087634413 11:100687061-100687083 AAGCGCGGGGCTGCAGCGCGGGG No data
1087634406_1087634426 26 Left 1087634406 11:100687046-100687068 CCAAGGCCGGAGCGCAAGCGCGG No data
Right 1087634426 11:100687095-100687117 CCAGTGCGGGCGGACGGGTGGGG No data
1087634406_1087634414 0 Left 1087634406 11:100687046-100687068 CCAAGGCCGGAGCGCAAGCGCGG No data
Right 1087634414 11:100687069-100687091 GGCTGCAGCGCGGGGAGCCCTGG No data
1087634406_1087634416 13 Left 1087634406 11:100687046-100687068 CCAAGGCCGGAGCGCAAGCGCGG No data
Right 1087634416 11:100687082-100687104 GGAGCCCTGGAGCCCAGTGCGGG No data
1087634406_1087634421 21 Left 1087634406 11:100687046-100687068 CCAAGGCCGGAGCGCAAGCGCGG No data
Right 1087634421 11:100687090-100687112 GGAGCCCAGTGCGGGCGGACGGG No data
1087634406_1087634411 -10 Left 1087634406 11:100687046-100687068 CCAAGGCCGGAGCGCAAGCGCGG No data
Right 1087634411 11:100687059-100687081 GCAAGCGCGGGGCTGCAGCGCGG No data
1087634406_1087634422 24 Left 1087634406 11:100687046-100687068 CCAAGGCCGGAGCGCAAGCGCGG No data
Right 1087634422 11:100687093-100687115 GCCCAGTGCGGGCGGACGGGTGG No data
1087634406_1087634415 12 Left 1087634406 11:100687046-100687068 CCAAGGCCGGAGCGCAAGCGCGG No data
Right 1087634415 11:100687081-100687103 GGGAGCCCTGGAGCCCAGTGCGG No data
1087634406_1087634424 25 Left 1087634406 11:100687046-100687068 CCAAGGCCGGAGCGCAAGCGCGG No data
Right 1087634424 11:100687094-100687116 CCCAGTGCGGGCGGACGGGTGGG No data
1087634406_1087634420 20 Left 1087634406 11:100687046-100687068 CCAAGGCCGGAGCGCAAGCGCGG No data
Right 1087634420 11:100687089-100687111 TGGAGCCCAGTGCGGGCGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087634406 Original CRISPR CCGCGCTTGCGCTCCGGCCT TGG (reversed) Intergenic
No off target data available for this crispr