ID: 1087637288

View in Genome Browser
Species Human (GRCh38)
Location 11:100716308-100716330
Sequence CTTCACAGTGAACCACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087637288 Original CRISPR CTTCACAGTGAACCACAAGC AGG (reversed) Intronic
900569433 1:3351125-3351147 CATCTCAGAGACCCACAAGCTGG - Intronic
903982318 1:27198090-27198112 GTTCATAGTGAGCCACAAGGTGG + Intergenic
915675004 1:157521209-157521231 CCTCACAGTGAAGCTCCAGCAGG + Exonic
915675324 1:157524474-157524496 CCTCACAGTGAAGCTCCAGCAGG + Exonic
915675690 1:157527812-157527834 CCTCACAGTGAAGCTCCAGCAGG + Exonic
915698345 1:157767426-157767448 CCTCACAGTGAAGCTCCAGCAGG + Exonic
919568439 1:199218375-199218397 CTTCTCTGTGTGCCACAAGCAGG + Intergenic
922918118 1:229275468-229275490 CATCACAAAGAACCACAAACTGG - Intronic
923334261 1:232953124-232953146 CTTGACAGTGCACCTCATGCTGG + Intronic
923656517 1:235921811-235921833 CTTAACAGAGAACCACCAACTGG - Intergenic
1064152609 10:12877293-12877315 CCTCACAATGAGCCACAATCAGG - Intergenic
1065109537 10:22426183-22426205 CTTCACAATTAACCACAGACAGG - Intronic
1066071624 10:31820440-31820462 GTTCACAGTGGACCTCAAGGGGG - Exonic
1070960859 10:80499374-80499396 CTTCACAGTGACCCACAAAGAGG + Intronic
1072637694 10:97188094-97188116 CTGGACAGTGAATCCCAAGCAGG + Intronic
1075904109 10:126065758-126065780 CCTAAAAGTGAACCACAATCAGG + Intronic
1077738791 11:4821562-4821584 GTTCACAGAGGACCACAAACAGG - Exonic
1082857586 11:57822400-57822422 CTTCAAAATGAAGCAAAAGCTGG + Intergenic
1086942713 11:92815052-92815074 CTTCACAAACAACCACAATCAGG - Intronic
1087309249 11:96521241-96521263 CTTCTCTGTGCCCCACAAGCAGG + Intergenic
1087637288 11:100716308-100716330 CTTCACAGTGAACCACAAGCAGG - Intronic
1089707151 11:120286937-120286959 AGCCACAGTGGACCACAAGCAGG + Intronic
1091085554 11:132718704-132718726 CTGCACAGGGAAGCACACGCGGG + Intronic
1094340004 12:29400866-29400888 CTTCACATTGAAACACAAAACGG + Intergenic
1096715371 12:53487910-53487932 CTTCACATTGAAGCACACACAGG + Intronic
1099422677 12:82482424-82482446 CTTCACAGTGCAGCTCAAGGGGG + Intergenic
1100981324 12:100164955-100164977 CTTCACAGTGTGCCTCACGCGGG + Intergenic
1101519462 12:105468128-105468150 AGCCACAGTGAACCATAAGCTGG - Intergenic
1106535168 13:30634222-30634244 CTGCTAAGTGAACCACAGGCAGG + Intronic
1106777843 13:33025825-33025847 CTTCACAGCAATTCACAAGCTGG - Intronic
1109492813 13:63126167-63126189 CTTAACAGAGGACCACAAACTGG + Intergenic
1110252526 13:73396581-73396603 CTTGACAGGGAACCAAAAGCAGG + Intergenic
1110437853 13:75495321-75495343 CTTCACATTGCTCCACAAGATGG + Intergenic
1111606883 13:90549929-90549951 ATTAACAATGAACCACAGGCTGG + Intergenic
1113093809 13:106641707-106641729 CATAACAAAGAACCACAAGCTGG - Intergenic
1115585458 14:34807467-34807489 CAACACTGTGAACCACAAGATGG - Exonic
1118741839 14:68745303-68745325 CTTCAAAGTGCAACAAAAGCTGG + Intergenic
1120504801 14:85342120-85342142 AATCACTGTCAACCACAAGCAGG + Intergenic
1122106147 14:99456972-99456994 CTGGACAATGAACTACAAGCTGG - Intronic
1125446072 15:39758361-39758383 CTCCAGAGTCAACCACAAGCAGG + Intronic
1126225057 15:46261222-46261244 CTTCTCTGTGCCCCACAAGCAGG + Intergenic
1129467882 15:75734070-75734092 CTACACAGTGACACGCAAGCAGG - Intergenic
1131449565 15:92528063-92528085 CTGCACAGTGACCCAGGAGCTGG - Intergenic
1132009589 15:98264561-98264583 AATCTCAGAGAACCACAAGCAGG + Intergenic
1133293234 16:4736470-4736492 CTTCTCAGTGCACCATAATCCGG - Exonic
1136692004 16:32039315-32039337 GGTCACAGAGAACCACAAGGGGG + Intergenic
1138023748 16:53506147-53506169 ACAAACAGTGAACCACAAGCAGG + Intergenic
1138702798 16:58882165-58882187 CTTCACACTGAACCTGCAGCTGG - Intergenic
1140949941 16:79807356-79807378 CTTAACATTGAACCAAAAACTGG + Intergenic
1153698636 18:7669375-7669397 CCTCTCAGTTAAACACAAGCAGG - Intronic
1155917108 18:31567948-31567970 CTTCACAATGAAAAATAAGCAGG + Intergenic
1158973747 18:62692175-62692197 CTTCACACCCAACCACCAGCAGG - Intergenic
1159241860 18:65751484-65751506 CCTCAAAGAGGACCACAAGCAGG + Intronic
1160037953 18:75318878-75318900 GTTCACAGTGCACCTGAAGCAGG - Intergenic
1160287604 18:77559476-77559498 CTTAACAAAGAAACACAAGCTGG + Intergenic
1162225311 19:9216347-9216369 CTACACAGTGAACCAGAGGCAGG - Intergenic
1162332506 19:10038934-10038956 GTTCACTGTGAACCACAAGATGG + Intergenic
1168503371 19:56912397-56912419 TTTCACAGGGCACCACGAGCAGG + Intergenic
927866699 2:26592462-26592484 ATTTACAGTGAACTCCAAGCAGG - Intronic
929601397 2:43206846-43206868 CTTCACAAAGAAACCCAAGCTGG - Intergenic
929705891 2:44211456-44211478 CTTCTCAGTGCATCACAATCAGG + Intronic
929814328 2:45219430-45219452 CTTTACAGTGAACCAGATGGAGG + Intergenic
931932752 2:67159248-67159270 CTTAATAGTGAAGAACAAGCAGG - Intergenic
935214352 2:100964353-100964375 CTTCAAAGAGAACCACTTGCAGG - Intronic
938473776 2:131589672-131589694 GTTAACAGTCAAACACAAGCAGG - Intergenic
940204231 2:151185043-151185065 CTACACTGTGAACAATAAGCTGG - Intergenic
941125704 2:161580750-161580772 CTTCACAGTCAACCCAAAGCTGG - Intronic
941645114 2:168031811-168031833 CTTAACAAAGAACCACAAACTGG - Intronic
946600948 2:221359415-221359437 CTTCAAACTGAACCATAAGCTGG + Intergenic
1171178597 20:23074598-23074620 CTTCCCAGTGAACCACAGGATGG + Intergenic
1174894915 20:54438167-54438189 CTTAACAATGTACCACAAACTGG + Intergenic
1175901817 20:62362933-62362955 TCTCACAGTAAACCACAAGGTGG + Intronic
1176944154 21:14958146-14958168 TTCCAGAGTGAACTACAAGCAGG + Intergenic
1177920900 21:27151094-27151116 GTGCAAAGTGAATCACAAGCAGG - Intergenic
1179089335 21:38250013-38250035 CTTCACACTGAAGGACTAGCAGG - Intronic
1180150790 21:45946222-45946244 TTTCACAGTGAACAATGAGCCGG + Intergenic
1185000946 22:48245149-48245171 CATCACAGTGAACCAGGAGAAGG + Intergenic
949096815 3:96192-96214 CTTCTCAGTGGAACACAAGAGGG - Intergenic
950230844 3:11274528-11274550 CACTCCAGTGAACCACAAGCAGG - Intronic
953167709 3:40480163-40480185 CTTCAGAGTCAACAACTAGCTGG - Intronic
954660991 3:52226689-52226711 CTACACAGTCAACTGCAAGCAGG - Intergenic
958048294 3:88313286-88313308 CTTCACAGAGAGGCACAAGATGG - Intergenic
960645124 3:119871800-119871822 CTTCAAAGTGAGCTACAAACTGG + Intronic
961662577 3:128477486-128477508 CTTCACAGGGAAGGACAAGAGGG + Intergenic
962140314 3:132783461-132783483 ATTCACAGTGATGAACAAGCAGG + Intergenic
962165784 3:133046303-133046325 CTTTACAGTGCACCTCAAGAGGG - Intronic
963913178 3:150832308-150832330 CTTTACAGTGATCCTCAAGGTGG - Intergenic
964062111 3:152537514-152537536 CTTCTCTGTGCCCCACAAGCAGG + Intergenic
974075496 4:57164826-57164848 CTTCAGAGAGAAACACCAGCTGG - Intergenic
974103309 4:57440927-57440949 GCACACTGTGAACCACAAGCTGG - Intergenic
974151335 4:58013818-58013840 CTTCAAAGCTAACCACAGGCAGG - Intergenic
974603709 4:64122398-64122420 CTTCTCTGTGTACCACAAGCAGG + Intergenic
975402963 4:73958575-73958597 CTTCAAGGAGAACCACAAACCGG + Intergenic
976755497 4:88493133-88493155 CTTGACAGGAAACCACATGCAGG - Exonic
977854735 4:101875899-101875921 CAACCCAGTGAAACACAAGCTGG + Intronic
978250433 4:106624986-106625008 CTTCACAGTAAACCAGAAATAGG - Intergenic
979157490 4:117415063-117415085 CCTCACAGTCTACCATAAGCAGG - Intergenic
979167546 4:117555317-117555339 CTTCACAGTGATGAACAAGAAGG + Intergenic
980377820 4:131974830-131974852 CCTCTCAGAGAACCACAAGAAGG + Intergenic
985876265 5:2599453-2599475 CATCACAGTAAACCAAGAGCAGG + Intergenic
990781755 5:59372592-59372614 CTTCTCTGTGCCCCACAAGCAGG - Intronic
991338924 5:65583650-65583672 TTTAAAAGTGAACTACAAGCTGG + Intronic
993607351 5:90008263-90008285 CTCCACAGTGAGCCACAAAAAGG + Intergenic
994486675 5:100391137-100391159 CTTCACATTGAACCCCATGTTGG + Intergenic
1001713495 5:173795954-173795976 CTACACAGTGAATCAGAGGCAGG - Intergenic
1002794016 6:456313-456335 CTTCACAGAGAACCTCTACCAGG - Intergenic
1003116193 6:3285364-3285386 CTTCACAGTGAGACCCCAGCAGG + Intronic
1004311306 6:14547839-14547861 GTTCAAAGTGCTCCACAAGCTGG - Intergenic
1005897388 6:30189810-30189832 CTACACAGAGAACCATAAGGAGG + Intronic
1012400090 6:98835455-98835477 CTTCACGGTGAACGGCATGCTGG + Exonic
1015325561 6:131919215-131919237 CTTCTCTGTGCCCCACAAGCAGG - Intergenic
1015348937 6:132194418-132194440 CTTCACAGTGAAACATTAACTGG - Intergenic
1015519040 6:134113443-134113465 CTTAAGAGTGAAGCCCAAGCTGG + Intergenic
1016051969 6:139539179-139539201 CTCCTCAGTGAACCAGAAACTGG - Intergenic
1016307625 6:142700058-142700080 GTTCACCGTGACCCAAAAGCTGG + Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1019693559 7:2431838-2431860 CTTCACAGTGACCCAACAACAGG - Intronic
1024458808 7:49638622-49638644 CATCACAAACAACCACAAGCTGG + Intergenic
1024462932 7:49678780-49678802 CTTAACAGTAAGCTACAAGCTGG + Intergenic
1030111840 7:106033445-106033467 CTTAAAAGTGAACTACAGGCAGG + Exonic
1031737355 7:125383171-125383193 CTTTACATTGAACCCCCAGCTGG - Intergenic
1032429653 7:131850261-131850283 CTTCATAATGTACCACAACCTGG + Intergenic
1032562766 7:132909637-132909659 CTTCACAGTGGAGCACAATGAGG + Intronic
1033681435 7:143599921-143599943 CATCACAGTGACCCCCAAGGGGG - Intergenic
1033703457 7:143861892-143861914 CATCACAGTGACCCCCAAGGGGG + Intronic
1034590205 7:152132111-152132133 CTGCACAGGGAGCCGCAAGCAGG + Intergenic
1034999573 7:155602291-155602313 CTTCACAGGAAAACACAACCCGG + Intergenic
1036613511 8:10370719-10370741 TGTCACAGTGAACGACAAGGAGG + Intronic
1036704263 8:11034875-11034897 CCTCACAGTGATGCATAAGCTGG + Intronic
1037746589 8:21650300-21650322 CTTCACAGAGAACCTCTACCAGG - Intergenic
1044127376 8:88474745-88474767 CTTCACTGTGCCTCACAAGCAGG - Intergenic
1044725336 8:95190335-95190357 CCTCACAATGAACCAGAAGATGG - Intergenic
1044882230 8:96735405-96735427 CTTCACAATGAAACAGAAGCTGG - Intronic
1045043377 8:98248944-98248966 CTTCACAGTGAAGCATAGACGGG + Intronic
1046086467 8:109443079-109443101 CTTCAGAGCGACCCACAAACAGG - Exonic
1047180268 8:122581012-122581034 CTTCACAAGGAACCACATGCTGG + Intergenic
1051658454 9:19404680-19404702 CTTAACAATGGGCCACAAGCAGG + Intergenic
1056907360 9:90665363-90665385 CTTCTCTGTGCCCCACAAGCAGG + Intergenic
1057090923 9:92257518-92257540 CTTGGCAGAGAACCACATGCAGG + Intronic
1058102892 9:100937024-100937046 CCTCACAGTGAACAAAAACCAGG - Intergenic
1059400316 9:114065545-114065567 CGTAACAGAGAACCACAAGCTGG - Intronic
1061475465 9:130862936-130862958 CATCACCATGAAGCACAAGCTGG + Exonic
1189167048 X:38870598-38870620 CTTCACATGGCACCCCAAGCAGG + Intergenic
1191760042 X:64636738-64636760 CAACCCAGTGAAACACAAGCTGG - Intergenic
1192838979 X:74834506-74834528 CTTCCCAGAGAAACAAAAGCTGG - Intronic
1195346440 X:103954712-103954734 CTTCTCTGTGCCCCACAAGCAGG - Intronic
1195567809 X:106363204-106363226 CTTCTCTGTGCCCCACAAGCAGG + Intergenic
1197404208 X:126029771-126029793 CTTCTCTGTGCACCACAAGCAGG + Intergenic
1197622101 X:128762400-128762422 CTTCACAAACACCCACAAGCGGG + Intergenic
1198428909 X:136546425-136546447 ATTCACAGTGATCCAACAGCGGG - Intronic
1200210288 X:154344124-154344146 CATCACAGAGAACCCCAAGAAGG + Intergenic
1200220564 X:154387968-154387990 CATCACAGAGAACCCCAAGAAGG - Intergenic
1200422429 Y:2985757-2985779 CTTCTCAGTAAAATACAAGCAGG - Intergenic
1201340767 Y:12930988-12931010 ATATACAGTGAACCTCAAGCAGG + Intergenic