ID: 1087640533

View in Genome Browser
Species Human (GRCh38)
Location 11:100750478-100750500
Sequence GCAGATAGTCAGAATGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 719
Summary {0: 1, 1: 1, 2: 57, 3: 232, 4: 428}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087640533 Original CRISPR GCAGATAGTCAGAATGAGTC AGG Intronic
900270701 1:1786283-1786305 GAAGATAGACAGGATGGGTCAGG + Exonic
901946007 1:12704244-12704266 GCAGGTAATCAGAATGAATGAGG + Intergenic
901946013 1:12704290-12704312 GCAGGTAATCGGAATGAGTCAGG + Intergenic
902050381 1:13559772-13559794 GCAGGTGATCAGAATGAGTCAGG - Intergenic
902052200 1:13572840-13572862 GCAGGTGATCAGAATGAGTCAGG - Intergenic
902052204 1:13572868-13572890 GCAGATAATTGGAATGAGTTAGG - Intergenic
902098731 1:13967584-13967606 TCAGATGGGGAGAATGAGTCTGG - Intergenic
902258535 1:15206660-15206682 GCTGATACTCAGCATGAATCAGG - Intronic
903635058 1:24807605-24807627 GCAGGTAATTGGAATGAGTCAGG + Intronic
904713589 1:32449739-32449761 GCAGGTAATCGGAATGAGTCAGG + Intergenic
904713593 1:32449767-32449789 GCAGGTAATTGGAATGAGTCAGG + Intergenic
906506585 1:46384112-46384134 GCAGGTAATTGGAATGAGTCAGG + Intergenic
906733619 1:48104144-48104166 GCAGACAGTGAGCAGGAGTCTGG + Intergenic
907963009 1:59299856-59299878 GCAGGAAATCGGAATGAGTCAGG + Intronic
909014374 1:70367220-70367242 GCAGGTGATCAGAATGAGTCAGG + Intronic
909238630 1:73183525-73183547 GCAGGTAATGGGAATGAGTCAGG - Intergenic
909238642 1:73183581-73183603 GCAGGTAATGGGAATGAGTCAGG - Intergenic
909238648 1:73183609-73183631 GCAGGTAATGGGAATGAGTCAGG - Intergenic
909238660 1:73183693-73183715 GCAGGTAATGGGAATGAGTCAGG - Intergenic
909238672 1:73183749-73183771 GCAGGTAATGGGAATGAGTCAGG - Intergenic
909238689 1:73183833-73183855 GCAGCTAATCAGAATTAGTCAGG - Intergenic
909238692 1:73183861-73183883 GCAGGTAATGAGAATGAGTCAGG - Intergenic
909238696 1:73183889-73183911 GCAGATAATCGGAATGACTCAGG - Intergenic
909673690 1:78215257-78215279 GCAGGAAATCGGAATGAGTCAGG - Intergenic
910807912 1:91206830-91206852 GCAGGCAATCGGAATGAGTCAGG + Intergenic
912989751 1:114473596-114473618 GCAGGTAATTGGAATGAGTCAGG + Intronic
913064461 1:115237749-115237771 GCAGGCAATCAGAATGAGTCAGG + Intergenic
916858261 1:168774493-168774515 GTAGAGAGACAGAAAGAGTCTGG + Intergenic
917311524 1:173684074-173684096 GCAGGTAATCAGAATGAGTTAGG + Intergenic
917311536 1:173684158-173684180 GTAGGTAATCAGAATGAGACAGG + Intergenic
917312570 1:173692078-173692100 GCAGATGATCAGAATGAGTTAGG + Intergenic
917506027 1:175627950-175627972 CACGATAGTCAGAATGAGCCAGG + Intronic
917951801 1:180045908-180045930 GGAAATAGTTAGAATGAGTGGGG - Intronic
918373106 1:183881493-183881515 GAAGAAAGTCAGAAAGAGGCTGG + Intronic
920703567 1:208235699-208235721 GCAGATGGTCAGGAAGAGCCTGG - Intronic
921740151 1:218675478-218675500 GCAGATAAACAGGATGAGACAGG - Intergenic
922694412 1:227721173-227721195 GCAGGTGATCAGAATGAGTCAGG + Intergenic
1063805318 10:9632705-9632727 GAAGATAGTTAGAATGAGTCAGG + Intergenic
1064756668 10:18577772-18577794 GCAGGTAATCAGAATGAGTCAGG - Intronic
1064773731 10:18752558-18752580 GCAGGTAATCGGAATGAGTTAGG - Intergenic
1064773735 10:18752586-18752608 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1064773740 10:18752614-18752636 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1064827383 10:19420263-19420285 GCAGGTAATCGGAATGAGTCAGG + Intronic
1064827388 10:19420291-19420313 GTAGGTAATCGGAATGAGTCAGG + Intronic
1065464315 10:26002566-26002588 GCAGGTAATCGGAATAAGTCAGG + Intronic
1065464321 10:26002594-26002616 CCAGGTAATCGGAATGAGTCAGG + Intronic
1065464327 10:26002622-26002644 CCAGGTAATCGGAATGAGTCAGG + Intronic
1065464333 10:26002650-26002672 CCAGGTAATCGGAATGAGTCAGG + Intronic
1065810586 10:29439155-29439177 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1065810590 10:29439183-29439205 GCAGGTAATCAGAATGAGTCAGG + Intergenic
1065810594 10:29439211-29439233 GCAGGTAATCGGATTGAGTCAGG + Intergenic
1065810604 10:29439267-29439289 GTAGGTAATCGGAATGAGTCAGG + Intergenic
1065986608 10:30959780-30959802 CCAGAGAGACAGAATGAATCAGG - Intronic
1066435224 10:35391419-35391441 GCAGATGACCGGAATGAGTCAGG + Intronic
1068985126 10:63101221-63101243 GCAGGTAATCGGAATGAGTCGGG - Intergenic
1069091490 10:64204641-64204663 GCAGGTAATCTGGATGAGTCAGG + Intergenic
1069091494 10:64204669-64204691 GTAGGTAATCTGAATGAGTCAGG + Intergenic
1069091498 10:64204697-64204719 GCAGGTAATTCGAATGAGTCAGG + Intergenic
1069412711 10:68169594-68169616 GCAGAAAGACAGAAGGAGACTGG - Intronic
1069733490 10:70634829-70634851 GCAGGTGATCAGAATGAGTCAGG + Intergenic
1071282740 10:84117371-84117393 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1071282900 10:84118848-84118870 GCAGGTAATGGGAATGAGTCAGG + Intergenic
1071283897 10:84126535-84126557 GCAGGTAATCAGAATGAGTCGGG + Intergenic
1071283906 10:84126591-84126613 GCAGGTAATGGGAATGAGTCAGG + Intergenic
1071377753 10:85027047-85027069 GTAGATAGTCTGAGTAAGTCAGG + Intergenic
1072033170 10:91540485-91540507 ACAGAGATTCAGAATGAGCCTGG + Intergenic
1075203390 10:120425263-120425285 ACAGATATCCAGAAAGAGTCAGG - Intergenic
1077937506 11:6803002-6803024 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1077938869 11:6818513-6818535 ACAGATTGTCCCAATGAGTCTGG - Intergenic
1079271238 11:18987760-18987782 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1079882114 11:25941477-25941499 GCAAATGATCAAAATGAGTCAGG - Intergenic
1080580866 11:33642623-33642645 GCAGGTAATTGGAATGAGTCAGG + Intronic
1080580869 11:33642651-33642673 GTAGGTAATCAGAATGAGTCAGG + Intronic
1080580874 11:33642679-33642701 GCAGGTAATCGGAATGAGTCAGG + Intronic
1080580879 11:33642707-33642729 GCAGGTAATTGGAATGAGTCAGG + Intronic
1081345359 11:41979138-41979160 GCAGGTAATTGGAATGAGTCAGG - Intergenic
1085543989 11:77300119-77300141 GCTGGTAATCAGAATGAGTCAGG - Intronic
1085543992 11:77300147-77300169 GCAGGTGATCAGGATGAGTCAGG - Intronic
1085702657 11:78758782-78758804 GCAGATAGTGATAAAGAGTATGG + Intronic
1086510815 11:87555865-87555887 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1086510820 11:87555893-87555915 GCAGGTAATCGGAATGAATCAGG + Intergenic
1086510824 11:87555921-87555943 GTAGGTAATCAGAATGAGTCAGG + Intergenic
1086825331 11:91489194-91489216 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1086825334 11:91489222-91489244 GCAGGCAATCAGAATGAGTCAGG + Intergenic
1086825338 11:91489250-91489272 GCAGGTAATCAAAATGAGTCAGG + Intergenic
1087456595 11:98394651-98394673 ACAGGTAATCGGAATGAGTCAGG + Intergenic
1087456600 11:98394679-98394701 GTAGGTAATCGGAATGAGTCAGG + Intergenic
1087640529 11:100750434-100750456 GCAGGAAATCGGAATGAGTCAGG + Intronic
1087640533 11:100750478-100750500 GCAGATAGTCAGAATGAGTCAGG + Intronic
1087640572 11:100750679-100750701 GCAGGAAATCGGAATGAGTCAGG + Intronic
1087640580 11:100750724-100750746 GCAGGTAGTCGGAATGAGTCAGG + Intronic
1087982960 11:104640189-104640211 ACAGCTAGACATAATGAGTCAGG + Intergenic
1088007655 11:104961877-104961899 GCAGATAGTCACCATGAGACAGG - Intronic
1088639605 11:111858711-111858733 GCAGAAAGTCTGAATCAGTAGGG + Intronic
1089956921 11:122580118-122580140 GCAGGTGATCGGAATGAGTCAGG - Intergenic
1089956926 11:122580146-122580168 GCAGGTAATCTGAATAAGTCAGG - Intergenic
1092847345 12:12596037-12596059 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1092847363 12:12596188-12596210 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1092847367 12:12596216-12596238 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1092847375 12:12596272-12596294 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1092847382 12:12596328-12596350 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1092847386 12:12596356-12596378 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1092847390 12:12596384-12596406 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1093356324 12:18172840-18172862 GCAGGTGCTCAGAATGAGTCAGG - Intronic
1093356968 12:18178196-18178218 GCCGGTAATCGGAATGAGTCAGG - Intronic
1093356973 12:18178224-18178246 GCAGGTGATCAGAATGAGTCAGG - Intronic
1093950464 12:25160414-25160436 GTAGGTGATCAGAATGAGTCAGG - Intronic
1093950470 12:25160470-25160492 GCAGGTAATCGGAATGAGTTAGG - Intronic
1094018664 12:25891224-25891246 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1094018675 12:25891297-25891319 GCAGGAAATCAGACTGAGTCAGG - Intergenic
1094413851 12:30197424-30197446 GCAGATAGTCAGAAATAAACAGG + Intergenic
1094475438 12:30837213-30837235 GCATGTAATCAGAATGAGTCAGG - Intergenic
1094475441 12:30837241-30837263 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1094582305 12:31744604-31744626 GCAGGTAATCAGAATGAGTTAGG + Intergenic
1094583774 12:31758379-31758401 GCAGGTGATCAAAATGAGTCAGG - Intergenic
1094583784 12:31758463-31758485 GCAGGTAATCAGAACGCGTCAGG - Intergenic
1094583799 12:31758547-31758569 GCAGGTAATGGGAATGAGTCAGG - Intergenic
1094606838 12:31956589-31956611 GCAGGAAATCGGAATGAGTCAGG + Intergenic
1095065994 12:37775658-37775680 GCAGTTGGTCAGAATGCTTCTGG - Intergenic
1096313040 12:50538387-50538409 GCCGATAGTCAGCATGAATTTGG + Intronic
1096471997 12:51884779-51884801 GCAGATAAACGGGATGAGTCAGG - Intergenic
1097757165 12:63419333-63419355 GCAGGTAATTGGAATGAGTCAGG - Intergenic
1097757170 12:63419367-63419389 GCAGGAAATCAGAATGAGTCTGG - Intergenic
1098175064 12:67781650-67781672 GCAGATAGTCAGATTTAACCAGG + Intergenic
1098547854 12:71731199-71731221 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1098571996 12:71998214-71998236 ACAGAAAGTCAGAGTGAGTTGGG - Intronic
1100716894 12:97315356-97315378 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1101387695 12:104272370-104272392 GCAGGTAATCGGAATGAGTCAGG + Intronic
1101565221 12:105898481-105898503 GCAGGTAATTAGAATGAGTCAGG + Intergenic
1102605516 12:114064632-114064654 GAAGGAAATCAGAATGAGTCAGG - Intergenic
1103941901 12:124505834-124505856 GCAGATAGGCAAACTGAGTCTGG + Intronic
1105458764 13:20565252-20565274 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1105458770 13:20565297-20565319 GCAGGAAATCGGAATGAGTCAGG - Intergenic
1105569046 13:21582641-21582663 GCAGGTAATTAGAATGAGTCAGG - Intronic
1105569653 13:21589664-21589686 GCAGGTAATCCGAATGAGTCAGG - Intronic
1107374675 13:39789520-39789542 GCAGGTGATCAGAATGAGTCAGG - Intronic
1107429916 13:40331114-40331136 GCAGGTAATCTGAATGAGTCAGG + Intergenic
1107429921 13:40331142-40331164 GCAGGTGATCGGAATGAGTCAGG + Intergenic
1107693552 13:42977622-42977644 GCAGAAAGTCAGAAGCAGTCTGG + Intronic
1107997606 13:45876198-45876220 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1109339424 13:61036468-61036490 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1109595183 13:64543674-64543696 GCAGAAAGTCACCATGAGACAGG - Intergenic
1109909254 13:68888985-68889007 GCAGGTAATCTGAATGAGTCAGG + Intergenic
1109909258 13:68889013-68889035 GCAGGTGATCCGAATGAGTCAGG + Intergenic
1109909263 13:68889041-68889063 GCAGGTGATCAGAATGAGTCAGG + Intergenic
1109909271 13:68889097-68889119 GTAGGTAATCAGAATGAGTCAGG + Intergenic
1112674326 13:101681088-101681110 GTTGATAGTCAAAATGTGTCTGG + Intronic
1113219555 13:108084557-108084579 GCAGTTAATCGGAATGAGTCAGG - Intergenic
1113524628 13:110965444-110965466 GTAAGTAATCAGAATGAGTCAGG - Intergenic
1113524634 13:110965489-110965511 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1113535097 13:111059693-111059715 GCAGGAAATCGGAATGAGTCAGG + Intergenic
1114235852 14:20823046-20823068 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1114236533 14:20828589-20828611 GCAGGTAATCTGAATGAGTCAGG + Intergenic
1114236537 14:20828623-20828645 GCAGGTAATCTGAATGAGTCAGG + Intergenic
1114236541 14:20828657-20828679 GCAGGTAATCTGAATGAGTCAGG + Intergenic
1114236545 14:20828691-20828713 GCAGGTAATCTGAATGAGTCAGG + Intergenic
1114236550 14:20828719-20828741 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1114513215 14:23279535-23279557 GCAGGTAATCGGAATGAGTCAGG + Intronic
1115239951 14:31244140-31244162 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1115794152 14:36913838-36913860 GTAGAAATTCAGAATAAGTCAGG + Intronic
1117179306 14:53176056-53176078 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1117179985 14:53181715-53181737 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1117179990 14:53181743-53181765 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1117179995 14:53181771-53181793 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1117180000 14:53181799-53181821 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1117180005 14:53181827-53181849 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1117180010 14:53181855-53181877 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1118391816 14:65302241-65302263 GCAGATAGTCAAAGTCAGGCGGG - Intergenic
1119692016 14:76680834-76680856 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1119692020 14:76680868-76680890 GCAGGAAATCGGAATGAGTCAGG - Intergenic
1120130117 14:80796519-80796541 GCAGAGAGTTAGAATGAGCAAGG - Intronic
1120873290 14:89357120-89357142 GCAGAAGGACAGCATGAGTCCGG + Intronic
1121673716 14:95734379-95734401 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1121673721 14:95734407-95734429 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1124000686 15:25757829-25757851 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000692 15:25757857-25757879 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000703 15:25757913-25757935 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000709 15:25757941-25757963 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000730 15:25758053-25758075 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000736 15:25758081-25758103 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000742 15:25758109-25758131 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000753 15:25758165-25758187 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000759 15:25758193-25758215 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000765 15:25758221-25758243 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000771 15:25758249-25758271 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000777 15:25758277-25758299 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000783 15:25758305-25758327 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000800 15:25758389-25758411 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000816 15:25758473-25758495 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000827 15:25758529-25758551 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000833 15:25758557-25758579 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000844 15:25758613-25758635 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000850 15:25758641-25758663 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000856 15:25758669-25758691 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000878 15:25758777-25758799 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000884 15:25758805-25758827 GCAGGTGGTCGGAATGAGTTAGG - Intronic
1124000901 15:25758885-25758907 GCAGGTGATCAGAATGAGTAAGG - Intronic
1124000905 15:25758913-25758935 GCAGGTGATCAGAATGAGTTAGG - Intronic
1124888397 15:33708966-33708988 GCAGGTAATCAGAATAAGTCAGG + Intronic
1124888401 15:33708994-33709016 GCAGGTGATCAGAATGAGTCAGG + Intronic
1125690558 15:41592884-41592906 GTAGGTGATCAGAATGAGTCAGG - Intergenic
1125690564 15:41592937-41592959 GCAGGTGATCAGAATGATTCAGG - Intergenic
1127553712 15:60066428-60066450 GCAGAGAGACAGAATGAGCCAGG - Intergenic
1128602336 15:69007802-69007824 GCAGATAATCAGAATGAGTTAGG - Intronic
1133584350 16:7178059-7178081 GCAGAAAGTCAGTATGTGTCAGG + Intronic
1135140401 16:19916354-19916376 GCAGAAAGACAGAAGGAGGCTGG + Intergenic
1138296582 16:55890987-55891009 GCAGGTAATCGGAATGAGTCAGG - Intronic
1138296587 16:55891015-55891037 GCAGATAATCGGAATGAGTCAGG - Intronic
1138296591 16:55891043-55891065 GCAGGTAATTGGAATGAGTCAGG - Intronic
1141297819 16:82786124-82786146 GCAGGTGATCAGAATGAGTCAGG + Intronic
1142987129 17:3702789-3702811 GCATATAGTCCCAATGTGTCTGG - Intergenic
1143312291 17:6002186-6002208 GCAGACAGTCAGGAAGAGGCTGG + Intronic
1144244296 17:13347646-13347668 GCAGGAAATCAGAATGAGTCAGG + Intergenic
1144267307 17:13583397-13583419 GCAGAGAGTCACAAGGAGTCTGG + Intronic
1149031810 17:52092096-52092118 GGAGAGAGTCAGAAGGAGACAGG - Intronic
1149695524 17:58613233-58613255 GCACATGGTCAGAATTAGTACGG - Intronic
1149942838 17:60888958-60888980 GAACATAGTCAGAATGACTAGGG + Intronic
1151894434 17:76970408-76970430 GCAGGTGATCAGAATGAATCAGG - Intergenic
1151894438 17:76970436-76970458 GCAGGTGATCAGAATGAGTCAGG - Intergenic
1151894442 17:76970464-76970486 GCAGGTAATCTGAATGAGTCAGG - Intergenic
1152651282 17:81494537-81494559 GCAGAAAGACTGAAAGAGTCTGG - Intergenic
1153650950 18:7239860-7239882 TCTGATAGTCAGAATGAGCCTGG + Intergenic
1153826093 18:8876291-8876313 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1153826199 18:8877165-8877187 GCAGGTAATCAGAATAAGTCAGG + Intergenic
1153826202 18:8877193-8877215 GTAGGTAATCAGAATGAGTCAGG + Intergenic
1153826906 18:8883175-8883197 GTAGATAATCAGAATGAGTCAGG + Intergenic
1153881189 18:9423027-9423049 GCAGGTAATCTGAATGAGTCAGG + Intergenic
1153881194 18:9423055-9423077 GCAGGTGATCGGAATGAGTCAGG + Intergenic
1155745967 18:29356652-29356674 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1155745975 18:29356708-29356730 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1155745978 18:29356736-29356758 GTAGGTAATCAGAATGAGTCAGG + Intergenic
1155745983 18:29356764-29356786 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1155745992 18:29356792-29356814 GCAGGTAATCGGAATGGGTCAGG + Intergenic
1155746643 18:29362431-29362453 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1155746654 18:29362487-29362509 GGAGGTAATCAGAATGGGTCAGG + Intergenic
1155803818 18:30141677-30141699 GCAGGAAATCAGAATGAGTCAGG + Intergenic
1155803827 18:30141739-30141761 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1155803831 18:30141767-30141789 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1157084819 18:44569084-44569106 GCAGATGGTTAGAGTGTGTCAGG - Intergenic
1157758412 18:50240071-50240093 GCAGGTAATCTGAATGAGTCAGG - Intronic
1157758416 18:50240099-50240121 GCAGGTAATTTGAATGAGTCAGG - Intronic
1157758423 18:50240155-50240177 GCAGGTAATTTGAATGAGTCAGG - Intronic
1157758429 18:50240183-50240205 GCAGGTAATCTGAATGAGTCAGG - Intronic
1157758433 18:50240211-50240233 GCAGGTGATCAGAATGAGTCAGG - Intronic
1157758439 18:50240239-50240261 GTAGGTGATCAGAATGAGTCAGG - Intronic
1157758445 18:50240267-50240289 GCAGGTAATCTGAATGAATCAGG - Intronic
1157758449 18:50240295-50240317 GCAGGTAATCAGAATGAGTTAGG - Intronic
1157758453 18:50240323-50240345 GCAGGTAATTGGAATGAGTCAGG - Intronic
1158084168 18:53630288-53630310 GCAGGTAATCGGAATGAGTAAGG + Intergenic
1158314771 18:56199797-56199819 GCACATGGTCAGAATGAGCGTGG - Intergenic
1160063804 18:75556004-75556026 GGAGATAGGCAGAATGAGACAGG - Intergenic
1160354231 18:78213474-78213496 GGAAATAGTCACAATGAGCCTGG - Intergenic
1162278100 19:9674287-9674309 GCAGGTAATCAGAATGAGTCAGG + Intronic
1162547421 19:11339172-11339194 GCAGATGGTTAGAAAGAGGCGGG - Intronic
1163050285 19:14678033-14678055 GCAGGTAATCGGAATGAGTTAGG + Intronic
1163050289 19:14678061-14678083 GCAGGTGATCAGAATGAGTCAGG + Intronic
1163927490 19:20360068-20360090 GCAGGTAATGGGAATGAGTCAGG - Intergenic
1163929527 19:20375727-20375749 GCAGGTAATGGGAATGAGTCAGG - Intergenic
1164655396 19:29917489-29917511 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1164763599 19:30746156-30746178 GCAGATGGTGAGGATCAGTCAGG - Intergenic
1166628286 19:44381306-44381328 GCAGATACAGAGAATGAGTGGGG + Intronic
1167633221 19:50638752-50638774 GCAGATAGACAAAAGGAGACAGG + Intronic
1167907077 19:52670209-52670231 GCAGGTAATCGGAGTGAGTCAGG - Intronic
925414649 2:3660813-3660835 GCAGGAAATCGGAATGAGTCAGG + Intronic
925414654 2:3660841-3660863 GCAGGTGATCGGAATGAGTCAGG + Intronic
925414659 2:3660869-3660891 GCAGGTGATCGGAATGAGTCAGG + Intronic
925590334 2:5503018-5503040 GCAGAAACTCAGAAAGAGCCTGG - Intergenic
927528084 2:23767142-23767164 GCAGGTAATTGGAATGAGTCAGG - Intronic
927528089 2:23767170-23767192 GTAGGTAATCGGAATGAGTCAGG - Intronic
927575567 2:24199346-24199368 GCAGGTGATCAGAATGAGTCAGG + Intronic
927993253 2:27463060-27463082 GGAGACAGACAGAATGAATCAGG + Intronic
928439880 2:31283585-31283607 GCAGGTAATCAGAATGAGTCAGG - Intergenic
928439883 2:31283612-31283634 GCAGGTAATCGGAATGAGTCAGG - Intergenic
928439888 2:31283640-31283662 GCAGGTAATCGGAATGAGTCAGG - Intergenic
928439892 2:31283667-31283689 GCAGGTAATCAGAATGAGTCAGG - Intergenic
928439895 2:31283694-31283716 GCAGGTAATCGGAATGAGTCAGG - Intergenic
929907442 2:46058574-46058596 GGTGATATGCAGAATGAGTCTGG - Intronic
931425787 2:62169820-62169842 GCAGGTGATCAGAATGAGTTAGG - Intergenic
931425790 2:62169848-62169870 GCAGATGATCAGAGTGAGTCAGG - Intergenic
931451659 2:62372289-62372311 GCAGAAATTCACAATGAGACAGG - Intergenic
932005168 2:67920308-67920330 ACAGGAAATCAGAATGAGTCAGG - Intergenic
933279081 2:80312444-80312466 GCAGGTGACCAGAATGAGTCAGG + Intronic
933390327 2:81658499-81658521 GTAGGTAATCGGAATGAGTCAGG + Intergenic
934677590 2:96260648-96260670 GCAGATAGACAGGAAGAGGCAGG - Intronic
935047643 2:99496856-99496878 GCAGGTAATCAGAATGAGTCGGG - Intergenic
935048602 2:99504186-99504208 GCAGGTAATCAGAATGAGTCAGG - Intergenic
936033682 2:109092262-109092284 GCAGATAGTCACCCTGAGACAGG - Intergenic
937472571 2:122186693-122186715 GCAGAAAGTGAGTCTGAGTCAGG - Intergenic
939166327 2:138644921-138644943 GCAGGAAATCGGAATGAGTCAGG + Intergenic
939166332 2:138644955-138644977 GCAGGTAATCGGAATGAGTCAGG + Intergenic
939166340 2:138645011-138645033 GTAGGTAATCGGAATGAGTCAGG + Intergenic
939670994 2:145012283-145012305 TGAGACAGTCAGAATGAGTCAGG + Intergenic
939913248 2:148008562-148008584 GCAGATGATCAGAATGAGTCAGG - Intronic
940303676 2:152202683-152202705 GCAGGTAATCAGAATGAGTTAGG - Intergenic
940802226 2:158145409-158145431 GCAGGTAATCAGAATGAGTCAGG - Intergenic
941876068 2:170434625-170434647 GCAGGTGATCAGAATGAGTCAGG + Intronic
943154199 2:184152043-184152065 GCAGGTAATTGGAATGAGTCAGG - Intergenic
943864746 2:192915357-192915379 TTAGGTAATCAGAATGAGTCAGG + Intergenic
944541308 2:200756385-200756407 GGAGATAGTCTGAATCTGTCTGG - Intergenic
945720459 2:213412085-213412107 GTAGGTGATCAGAATGAGTCAGG - Intronic
946004067 2:216507926-216507948 GCAGATAAGGAGAATGAGGCTGG - Intronic
946570420 2:221018273-221018295 TCAGATAGCCAGACTGAGACAGG - Intergenic
947498001 2:230652822-230652844 GCAGGTGATCAGAATGAGTCAGG - Intergenic
947556381 2:231096905-231096927 GCAGATGATCGGAATGAGTCAGG + Intronic
948138596 2:235656490-235656512 GCAGGTAATCGGAATGAGTCAGG - Intronic
948358526 2:237399952-237399974 GCTGATAATGAGATTGAGTCTGG - Intronic
948878424 2:240842558-240842580 GCAGGTAATCAGAATGAGTCGGG + Intergenic
948878430 2:240842585-240842607 GCAGGTGATCGGAATGAGTCAGG + Intergenic
948878435 2:240842613-240842635 ATAGGTAATCAGAATGAGTCGGG + Intergenic
948878441 2:240842640-240842662 GCAGGTGATCGGAATGAGTCTGG + Intergenic
948878445 2:240842668-240842690 GTAGGTAATCAGAATGAGTCGGG + Intergenic
948878450 2:240842694-240842716 GCAGGTGATCGGAATGAGTCAGG + Intergenic
948878456 2:240842721-240842743 GCAGGTAATCAGAATGAGTCGGG + Intergenic
948878461 2:240842747-240842769 GCAGGTGATCGGAATGAGTCTGG + Intergenic
948878465 2:240842775-240842797 GTAGGTAATCAGAATGAGTCGGG + Intergenic
948878470 2:240842801-240842823 GCAGGTGATCGGAATGAGTCAGG + Intergenic
948878475 2:240842829-240842851 GTAGGTAATCAGAATGAGTCGGG + Intergenic
948878481 2:240842856-240842878 GCAGGTGATCGGAATGAGTCTGG + Intergenic
948878485 2:240842884-240842906 GTAGGTAATCAGAATGAGTCGGG + Intergenic
948878489 2:240842910-240842932 GCAGGTAATCAGAATGAGTCAGG + Intergenic
948878494 2:240842938-240842960 GTAGGTAATCAGAATGAGTCGGG + Intergenic
948878500 2:240842965-240842987 GCAGGTGATCGGAATGAGTCTGG + Intergenic
948878504 2:240842993-240843015 GTAGGTAATCAGAATGAGTCGGG + Intergenic
948878515 2:240843046-240843068 GCAGGTGATCGGAATGAGTCAGG + Intergenic
948878521 2:240843073-240843095 GCAGGTGATCGGAATGAGTCTGG + Intergenic
948878525 2:240843101-240843123 GTAGGTAATCAGAATGAGTCGGG + Intergenic
948878536 2:240843154-240843176 GCAGGTGATCGGAATGAGTCAGG + Intergenic
948878542 2:240843181-240843203 GCAGGTAATCAGAATGAGTCGGG + Intergenic
948878547 2:240843207-240843229 GCAGGTGATCGGAATGAGTCTGG + Intergenic
948878551 2:240843235-240843257 GTAGGTAATCAGAATGAGTCGGG + Intergenic
948878556 2:240843261-240843283 GCAGGTGATCGGAATGAGTCAGG + Intergenic
948878561 2:240843289-240843311 GTAGGTAATCAGAATGAGTCGGG + Intergenic
948878567 2:240843316-240843338 GCAGGTGATCGGAATGAGTCTGG + Intergenic
948878571 2:240843344-240843366 GTAGGTAATCAGAATGAGTCGGG + Intergenic
948878583 2:240843397-240843419 GCAGGTGATCGGAATGAGTCGGG + Intergenic
948878589 2:240843424-240843446 GCAGGTGATCGGAATGAGTCTGG + Intergenic
948878593 2:240843452-240843474 GTAGGTAATCAGAATGAGTCGGG + Intergenic
948878605 2:240843505-240843527 GCAGGTGATCGGAATGAGTCTGG + Intergenic
1168823302 20:791920-791942 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1168824469 20:800511-800533 GCAGGTAATCGGAGTGAGTCAGG - Intergenic
1168824474 20:800539-800561 GCAGGTAATCGGAGTGAGTCAGG - Intergenic
1168824479 20:800567-800589 GCAGGTAATCGGAGTGAGTCAGG - Intergenic
1168824484 20:800595-800617 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1171029262 20:21662698-21662720 GCAGATAGCGAGAGTGAGTATGG + Intergenic
1171236442 20:23529243-23529265 GAAGGAAATCAGAATGAGTCAGG + Intergenic
1171236448 20:23529288-23529310 GAAGGTAATCAGAATGAGTCAGG + Intergenic
1171762141 20:29214766-29214788 GTAGATTGTCAGAATGCTTCTGG - Intergenic
1173443477 20:43097345-43097367 GCAGGTACTCACAATGACTCTGG - Intronic
1174079021 20:47957851-47957873 GCAGAAAGGCAGAAGGAGCCAGG - Intergenic
1176698978 21:10020047-10020069 GCAGAAGGTAAGAATGATTCTGG + Intergenic
1177327700 21:19613725-19613747 ACAGAAAGGGAGAATGAGTCTGG - Intergenic
1177999469 21:28143388-28143410 GCAGATGGGTAGAATGAGGCTGG - Intergenic
1178836665 21:36104390-36104412 GCAGGTAATCAGAATGAGTCCGG - Intergenic
1178837332 21:36110004-36110026 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1180577484 22:16792901-16792923 GCAGATAATCAACATGCGTCTGG + Intronic
1180857700 22:19058796-19058818 ACAGCAAGTCAGAGTGAGTCAGG + Intronic
1182136680 22:27911057-27911079 GAAGCTAGTAAGAATGAGACTGG - Exonic
1185151780 22:49167883-49167905 GAAGATATTCAGAATGTGTAGGG - Intergenic
949109129 3:237261-237283 GCAGAGAGACAGAGTGAGTGGGG - Intronic
949204769 3:1424768-1424790 GCAGCTAGTGTGAAGGAGTCAGG + Intergenic
949610769 3:5701180-5701202 GCAGGTAATCAGAATGAGTCAGG + Intergenic
949611634 3:5708834-5708856 GCAGGTATTCGGAATGAGTCAGG + Intergenic
949787353 3:7756835-7756857 GCAGGTGATCAGAATGAGTCAGG - Intergenic
949787356 3:7756863-7756885 GCAGGTAATCGGAATGAGTTAGG - Intergenic
950332951 3:12171076-12171098 TCAGATACCCAGAAAGAGTCAGG - Intronic
950845905 3:16015817-16015839 GCAGGTAATCGGAATGAGTTAGG + Intergenic
950845915 3:16015873-16015895 GCAGGTGATCGGAATGAGTCAGG + Intergenic
950845919 3:16015901-16015923 GTAGGTAATCAGAATGAGTCAGG + Intergenic
950846987 3:16024063-16024085 GCAGGTAATCAGAATGAGTCAGG + Intergenic
950846993 3:16024091-16024113 GCAGGTGGTCGGAATGAGTCAGG + Intergenic
950855583 3:16101616-16101638 GCAGGAAATCAAAATGAGTCAGG + Intergenic
950855597 3:16101717-16101739 GCAGTTGATGAGAATGAGTCTGG + Intergenic
950855601 3:16101745-16101767 GCAGGTAATCGGAGTGAGTCAGG + Intergenic
952637558 3:35550195-35550217 GCAGAAAGTCCCAATGGGTCAGG - Intergenic
952761711 3:36921055-36921077 GCAGGTAACCAGGATGAGTCAGG - Intronic
953972847 3:47360452-47360474 GCAGGTAATCGGAATGAGTCAGG + Intergenic
954481008 3:50801378-50801400 GCAGGTAATTGGAATGAGTCAGG + Intronic
954481012 3:50801406-50801428 GCAGATAATTGGAATGAGTCAGG + Intronic
954604317 3:51897084-51897106 GCAGGTAATGGGAATGAGTCAGG - Intronic
954604323 3:51897118-51897140 GCAGGAAATCGGAATGAGTCAGG - Intronic
954604969 3:51902496-51902518 GTAGGTAATCAGAATGAGTCAGG - Intronic
954604976 3:51902524-51902546 GCCGGTAATCGGAATGAGTCAGG - Intronic
954604981 3:51902552-51902574 GCAGGTAATTGGAATGAGTCAGG - Intronic
954604986 3:51902586-51902608 GCAGGAAATCGGAATGAGTCAGG - Intronic
955623265 3:60889100-60889122 GCAGGTAATCAGAATGAGTCAGG - Intronic
957975125 3:87433553-87433575 GCAGGTAATTGGAATGAGTCAGG - Intergenic
957975130 3:87433581-87433603 GTAGGTAATCGGAATGAGTCAGG - Intergenic
957975134 3:87433609-87433631 GCAGGAAATCAGAATGAGTCAGG - Intergenic
958796692 3:98713576-98713598 GCAGGTAATCAGAATGAGTCAGG + Intergenic
959175496 3:102904474-102904496 GCAGGTGATCAGAATGAATCAGG + Intergenic
960576482 3:119234927-119234949 GCAGGTAGTCAGAAAAAGACTGG - Intronic
960720090 3:120617028-120617050 GCAGGTAATCAGAATGAGTCAGG + Intergenic
960720920 3:120623627-120623649 GTAGATAATCGGCATGAGTCAGG + Intergenic
960823535 3:121758956-121758978 GGAGATAGCCAGCATGAGTGAGG - Intergenic
961957410 3:130818284-130818306 GCAGGTAATTGGAATGAGTCAGG + Intergenic
961957414 3:130818312-130818334 GCAGGTAATCAGAATGAGTCAGG + Intergenic
962562191 3:136618174-136618196 GCAGGTGATCGGAATGAGTCAGG - Intronic
963226557 3:142868512-142868534 GCAGGTGATCAGAATGAGTCAGG - Intronic
963226561 3:142868540-142868562 GCAGGTGATCAGAATGAGTCAGG - Intronic
963226564 3:142868568-142868590 GCAGGTAATCTGAATGAGTTAGG - Intronic
963948356 3:151170810-151170832 GCAGGTAGTGGGAATGAGTCGGG + Intronic
964772749 3:160240980-160241002 GCAGGTAATTGGAATGAGTCAGG + Intronic
964902966 3:161682003-161682025 GCAGGTAATCAGAATGAGTCAGG + Intergenic
964902976 3:161682055-161682077 GCAAGTAATTAGAATGAGTCAGG + Intergenic
965509680 3:169554770-169554792 GCAGCTAGTCAGGCTGAATCTGG + Intronic
966043698 3:175523795-175523817 GCAGGTAATCGGTATGAGTCAGG + Intronic
966306512 3:178541907-178541929 GCAGGTAATCAGAATGAGTCAGG - Intronic
966831243 3:184011041-184011063 GGAGATATTAAGAATGAGTTTGG - Intronic
967626061 3:191685331-191685353 GCAGATAGGCAAAATAAGACTGG + Intergenic
967659015 3:192082392-192082414 GCAGATAGTTTGAAAGAGACAGG - Intergenic
969340949 4:6540951-6540973 GCAGATAGACAGAAGGGATCTGG - Intronic
970092458 4:12426038-12426060 GCAGGTAATCAGAATGAGTCAGG + Intergenic
970092463 4:12426066-12426088 GCAGGTAATCGGAATGAGTCAGG + Intergenic
970093104 4:12431480-12431502 GCAGGTAATCGGAATGAGTCAGG + Intergenic
970093111 4:12431508-12431530 GCAGGTAATCGGAATGAGTCAGG + Intergenic
971066813 4:23042376-23042398 GCAGGTAATCGGAATGAGTCAGG - Intergenic
971241945 4:24897323-24897345 GGAGAAAGTCAAAATAAGTCTGG + Intronic
972102289 4:35436058-35436080 CCAGCTACTCAGAATGAGGCAGG + Intergenic
972784381 4:42313533-42313555 GCATGTAATCGGAATGAGTCAGG - Intergenic
972784384 4:42313561-42313583 GTAGGTAATCTGAATGAGTCAGG - Intergenic
972784395 4:42313651-42313673 GCAGGAAATCAGAATGTGTCAGG - Intergenic
972785205 4:42320273-42320295 GCAGGTAATCGGAATGAGTCAGG - Intergenic
973006742 4:45017334-45017356 GTAGATAATCAGAATGAGCCAGG - Intergenic
973006751 4:45017390-45017412 GCAGGTGATCAGAATGAGTTAGG - Intergenic
973666374 4:53163616-53163638 GCAGCTACTCAGGATGAGGCAGG + Intronic
974374110 4:61054620-61054642 GTAGAAAGTTAGAATGAGACTGG + Intergenic
975204951 4:71634714-71634736 GCAGGTAATCTGAATGAGCCAGG + Intergenic
975911949 4:79277606-79277628 GCAGGTAATCAGAATGAGTCAGG - Intronic
975911958 4:79277662-79277684 GCAGGTAATCGGAATGAGTTAGG - Intronic
977594543 4:98864653-98864675 GTAGGTAATCAGAATGAGTCAGG - Intergenic
978314409 4:107419617-107419639 GCAGGTAATCAGAATGAGTCAGG - Intergenic
978314416 4:107419673-107419695 GTAGGTAATCAGAATGAGTCAGG - Intergenic
978314423 4:107419729-107419751 GCAGGTAATCAGAATGAGTCAGG - Intergenic
979548639 4:121965107-121965129 GAAGAGAGTGATAATGAGTCAGG - Intergenic
979619810 4:122786466-122786488 GCAGGTAATTGGAATGAGTCAGG - Intergenic
979770728 4:124521759-124521781 GCAGGTAATTGGAATGAGTCAGG + Intergenic
980341129 4:131548824-131548846 ACAGGTAATCAGAATGAGTCAGG - Intergenic
980341133 4:131548858-131548880 GCAGGAAATCGGAATGAGTCAGG - Intergenic
980371441 4:131879366-131879388 GCAGAAGGTAAGAATGATTCTGG + Intergenic
980438570 4:132812912-132812934 GCAGGTAATCAGAATGAGTCAGG + Intergenic
980438574 4:132812939-132812961 GTAGGTAATCGGAATGAGTCAGG + Intergenic
980439288 4:132818729-132818751 GCAGGTAATTGGAATGAGTCAGG + Intergenic
981476935 4:145196663-145196685 GCAGGTGGTCAGAATGAGTTAGG + Intergenic
981476939 4:145196691-145196713 GCAGGTGATCAGAATGAGTTAGG + Intergenic
982430020 4:155312232-155312254 GCAGGTAATCAGAATGAGTCAGG + Intergenic
982823886 4:159978075-159978097 GCAGATAATCGGAATGAGTTAGG - Intergenic
982886003 4:160783593-160783615 GCAGGTAATCTGAATGAGTCAGG + Intergenic
982886007 4:160783621-160783643 GCAGGTAATCTGAATGAGTCAGG + Intergenic
982886011 4:160783649-160783671 GCAGGTAATCAGAACGAGTCAGG + Intergenic
982889310 4:160826595-160826617 GCACGGAATCAGAATGAGTCAGG + Intergenic
983583379 4:169330923-169330945 GCAGGTGATCGGAATGAGTCAGG - Intergenic
983583388 4:169330979-169331001 GCAGATAATCTGAACGAGTTAGG - Intergenic
984647016 4:182231257-182231279 GGACTTGGTCAGAATGAGTCAGG - Intronic
985421188 4:189786546-189786568 GGATCTAGTCAGCATGAGTCTGG - Intergenic
985718101 5:1474056-1474078 ACAGATACTCAGAAAGAGCCAGG - Exonic
987117062 5:14734198-14734220 GCAGGAAATCGGAATGAGTCAGG - Intronic
988038399 5:25857691-25857713 GCAGGTAATCGGAATGAGTCAGG + Intergenic
988206124 5:28137244-28137266 GCAGGTAATCCGAATGAGTCAGG + Intergenic
988969674 5:36454597-36454619 GCAGGTAATCAGAATGCGTCAGG - Intergenic
989388635 5:40877831-40877853 GCAGGTAATCAGAGTGAGTCAGG + Intergenic
989388642 5:40877887-40877909 GCAGGTAATCAGAATGAATCAGG + Intergenic
992188039 5:74262924-74262946 GCAGTTAGTCAGAAGGGGCCTGG - Intergenic
992614001 5:78532480-78532502 GCAGAAAGACAGAAAGAGCCTGG + Intronic
993054811 5:82969442-82969464 GCAGGTAATTGGAATGAGTCAGG + Intergenic
993055610 5:82975972-82975994 GCAAGTGATCAGAATGAGTCAGG + Intergenic
993055626 5:82976055-82976077 GCAGGTAATTGGAATGAGTCAGG + Intergenic
993055636 5:82976111-82976133 GCAGGTGATCAGAATGAGTCAGG + Intergenic
993130716 5:83895079-83895101 GAACATAGTCAGAATTAGTACGG - Intergenic
993784348 5:92110125-92110147 GCAGATGGTCATAATGATTTTGG + Intergenic
994192258 5:96881657-96881679 GCAGAAAGACAGAAGGAGCCTGG - Intronic
994430409 5:99652684-99652706 GCAGGTGATCTGAATGAGTCAGG - Intergenic
994430415 5:99652740-99652762 GCAGGTGATCAGAATGAGTGAGG - Intergenic
994622661 5:102181136-102181158 GCAGATAATTGGAATGAGTTAGG + Intergenic
995129005 5:108609910-108609932 GCAGGTGATCAGAATGAGTTAGG + Intergenic
995129010 5:108609938-108609960 GCAGGTGGTCAGAATGAGTTAGG + Intergenic
995227467 5:109717683-109717705 GGAGCTAGGCAGAATGAGGCAGG + Intronic
995510190 5:112901410-112901432 TTAGATGGTCAGATTGAGTCCGG + Intronic
995731645 5:115249574-115249596 GCAGGTAATCGGAATGAGTCAGG + Intronic
995731650 5:115249602-115249624 GCAGGTAATTGGAATGAGTCAGG + Intronic
995731654 5:115249630-115249652 GCAGGTAATCAGAATGAGTCAGG + Intronic
995794658 5:115928844-115928866 TCAGGTAATCGGAATGAGTCAGG + Intergenic
995794663 5:115928872-115928894 GCAGGTAATCGGAATGAGTCAGG + Intergenic
995794668 5:115928900-115928922 GCAGGTAATCGGAATGAGTCAGG + Intergenic
995794672 5:115928928-115928950 TCAGGTAATCGGAATGAGTCAGG + Intergenic
995794676 5:115928956-115928978 TCAGGTAATCGGAATGAGTCAGG + Intergenic
995794681 5:115928984-115929006 GCAGGTAATCGGAATGAGTCAGG + Intergenic
995794685 5:115929012-115929034 TCAGGTAATCGGAATGAGTCAGG + Intergenic
995794690 5:115929040-115929062 GCAGGTAATCGGAATGAGTCAGG + Intergenic
995794695 5:115929068-115929090 GCAGGTAATCGGAATGAGTCAGG + Intergenic
995794700 5:115929096-115929118 GCAGGTAATCGGAATGAATCAGG + Intergenic
995794710 5:115929153-115929175 GCAGGTAATTGGAATGAGTCTGG + Intergenic
995794849 5:115930330-115930352 GCAGGTAATCGGAATGAGTCAGG + Intergenic
995794853 5:115930358-115930380 TCAGGTAATCGGAATGAGTCAGG + Intergenic
995794873 5:115930470-115930492 GCAGGTAATCGGAATGAGTCAGG + Intergenic
995794877 5:115930498-115930520 TCAGGTAATCGGAATGAGTCAGG + Intergenic
996101360 5:119448953-119448975 GCAGGTAATCAGAATGAGACAGG - Intergenic
997754911 5:136387170-136387192 GTAGGTAATCGGAATGAGTCAGG - Intronic
998552247 5:143088893-143088915 GCAGATAATCGGAATGAGTCAGG + Intronic
998552254 5:143088921-143088943 GCAGGTAATGGGAATGAGTCAGG + Intronic
998552264 5:143088977-143088999 GTAGGTAATCGGAATGAGTCAGG + Intronic
998552983 5:143094811-143094833 GCAGGTAATCAGAATGAGTCAGG + Intronic
998552990 5:143094839-143094861 GCAGGTAATGGGAATGAGTCGGG + Intronic
998552995 5:143094867-143094889 GCAGGTAATCGGAATGAGTCAGG + Intronic
998938349 5:147254779-147254801 GCAGGTGATCTGAATGAGTCAGG + Intronic
998939147 5:147261529-147261551 GTAGGTGATCAGAATGAGTCAGG + Intronic
999118559 5:149187704-149187726 GTAGGTAATCAGAATGAGTCAGG - Intronic
999118563 5:149187732-149187754 GCATGTGATCAGAATGAGTCAGG - Intronic
999118566 5:149187760-149187782 GCAGGTAATCTGAATGAGTTAGG - Intronic
999446926 5:151647557-151647579 GCAGAGAAACAGAGTGAGTCAGG - Intergenic
999789942 5:154930080-154930102 GCAGGTAATCGGAATGAGTCAGG - Intronic
999789947 5:154930108-154930130 GCAGGAAATCAGAATGAGTCAGG - Intronic
1001558256 5:172650909-172650931 GCAGGTAATCGGAATGAGTTAGG + Intronic
1001558263 5:172650986-172651008 GCAGGTGATCAGAATGAGTTAGG + Intronic
1001558879 5:172656194-172656216 GCAGGTAATCATAATGAGTTAGG + Intronic
1001739995 5:174045266-174045288 GGAGATAGTCTGAAAGAGGCTGG + Intergenic
1003485517 6:6573786-6573808 GCAGAAAGTCAGAATAATTGAGG - Intergenic
1004317251 6:14600449-14600471 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1005853860 6:29845469-29845491 GCAAGTAATCAGGATGAGTCAGG - Intergenic
1005853864 6:29845497-29845519 GCAGGTAACCAGAATGAGTCAGG - Intergenic
1005853873 6:29845553-29845575 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1005853887 6:29845637-29845659 ACAGGTGATCAGAATGAGTCAGG - Intergenic
1006326240 6:33356100-33356122 GCAGGAGATCAGAATGAGTCAGG + Intergenic
1006882096 6:37349345-37349367 GGAGATAGCTAGAATGATTCAGG + Intergenic
1007770106 6:44185465-44185487 GCAGGTGATCGGAATGAGTCAGG - Intergenic
1008104905 6:47430894-47430916 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1008280219 6:49587494-49587516 ACAGGTAATCGGAATGAGTCAGG + Intergenic
1008280223 6:49587522-49587544 GTAGGTAATCGGAATGAGTCAGG + Intergenic
1008580122 6:52899049-52899071 GCAGGTAATCAGAATGAGTCAGG + Intronic
1008580126 6:52899077-52899099 GCAGGTAATCGGAATGAGTTAGG + Intronic
1008580132 6:52899105-52899127 GCAGGTAATCGGAATGGGTCAGG + Intronic
1008580142 6:52899161-52899183 GCAGGTGATCGGAATGAGTCAGG + Intronic
1009635357 6:66258797-66258819 GCAGATAATTGGAATGAGTTGGG - Intergenic
1009635362 6:66258825-66258847 GCAGGTAATTGGAATGAGTCAGG - Intergenic
1009635367 6:66258859-66258881 GCAGGAAATCTGAATGAGTCAGG - Intergenic
1009635984 6:66264479-66264501 GCAGATAATCGGAATGTGTCAGG - Intergenic
1009635990 6:66264535-66264557 GCAGTTATTAGGAATGAGTCAGG - Intergenic
1010397175 6:75405806-75405828 GCAGACAATCGGAATGAGTCGGG + Intronic
1011123126 6:83977001-83977023 GCAGGTCATCGGAATGAGTCAGG - Intergenic
1011317249 6:86049193-86049215 GCAGGTAATCAGAATGAGTTAGG + Intergenic
1011317253 6:86049221-86049243 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1011365877 6:86582035-86582057 GCAGGAAATCAGAATGAGTCAGG + Intergenic
1011365884 6:86582097-86582119 GCCGATAATCGGAATGAGTCAGG + Intergenic
1011449622 6:87479042-87479064 GCAGGAAATCGGAATGAGTCAGG + Intronic
1011450328 6:87484700-87484722 GCAGGTAATCGGAATGAGTCAGG + Intronic
1011569935 6:88724798-88724820 GCAGGTAATGGGAATGAGTCAGG - Intronic
1011570592 6:88730258-88730280 GCAGGTAATGGGAATGAGTCAGG - Intronic
1011980850 6:93376004-93376026 GAAGATAGTCAGAAGGAGGTGGG + Intronic
1013814560 6:114082772-114082794 GCAGGTAATTGGAATGAGTCAGG - Intronic
1014110289 6:117612947-117612969 GCAGGTGATCAAAATGAGTCAGG + Intergenic
1015405803 6:132835733-132835755 GCAGACAGTCAGATTGAATTAGG - Intergenic
1015457346 6:133441730-133441752 GCAGGTAATCAGAATGAGCCAGG + Intronic
1015457351 6:133441758-133441780 GCAGGTAATTGGAATGAGTCAGG + Intronic
1015457355 6:133441786-133441808 GCAGGTAATCAGAATGAGTCAGG + Intronic
1015521432 6:134135416-134135438 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1015521436 6:134135444-134135466 GTAGGTAATCAGAATGAGTCAGG + Intergenic
1016925017 6:149336049-149336071 TCAGAGCTTCAGAATGAGTCAGG + Intronic
1017133461 6:151128213-151128235 GCAGGTAATCTGAATGAATCAGG - Intergenic
1017177946 6:151522439-151522461 GCAGGTGATCGGAATGAGTCAGG - Intronic
1017270259 6:152495590-152495612 GCAGGTAATCGGAATGAGTCAGG - Intronic
1017270264 6:152495618-152495640 ACAGGTAATCAGAATGAGTCAGG - Intronic
1018181167 6:161225020-161225042 GCAGGTAGTTGGAAGGAGTCAGG - Intronic
1018181173 6:161225048-161225070 GCAGGTAATCGGAATGAGTCAGG - Intronic
1018181182 6:161225107-161225129 GCAGGTAATCCGAATGAGTCTGG - Intronic
1018191148 6:161309987-161310009 GCAGGTAATCTGAACGAGTCAGG + Intergenic
1018191153 6:161310015-161310037 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1018191810 6:161315446-161315468 GCAGGTAATAGGAATGAGTCAGG + Intergenic
1018191814 6:161315474-161315496 GCAGGTAATCCGAAGGAGTCAGG + Intergenic
1018191818 6:161315502-161315524 GCAGGTAATCAGAATGAGTCAGG + Intergenic
1018191822 6:161315530-161315552 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1018191827 6:161315558-161315580 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1018191832 6:161315586-161315608 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1018191841 6:161315644-161315666 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1018191850 6:161315702-161315724 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1018191853 6:161315730-161315752 GCAGGTAATCAGAATGAGTCAGG + Intergenic
1020272894 7:6607515-6607537 CCTGAAATTCAGAATGAGTCCGG - Intronic
1020459922 7:8417852-8417874 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1020655966 7:10928390-10928412 GCAGGTAATCAGAATGAGGGTGG - Intergenic
1023436101 7:40142054-40142076 GCAGGAAATCTGAATGAGTCAGG + Intronic
1023436117 7:40142172-40142194 GCAGGTAATCGGAATGAGTCAGG + Intronic
1023436122 7:40142200-40142222 GCAGGTAATTGGAATGAGTCAGG + Intronic
1023436821 7:40148122-40148144 GCAGGAAATCGGAATGAGTCAGG + Intronic
1023443756 7:40210816-40210838 GCAGATAATTGGAATGAGTTAGG + Intronic
1023443766 7:40210869-40210891 GCAGGTGATCAGAATGAGTCAGG + Intronic
1023798053 7:43810334-43810356 GCAGGAAATCGGAATGAGTCAGG - Intergenic
1023798501 7:43813409-43813431 GCAGGTAATCGGAATGAGTTAGG - Intergenic
1023799294 7:43819652-43819674 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1023799733 7:43823573-43823595 GCAGGAAATCGGAATGAGTCAGG - Intergenic
1026799279 7:73388671-73388693 GCAGGAAATCGGAATGAGTCAGG + Intergenic
1026799284 7:73388705-73388727 GCAGGTAATCGGAATGATTCAGG + Intergenic
1026799288 7:73388733-73388755 GCAGGTAATCAGAATGAGTCAGG + Intergenic
1027419352 7:78004671-78004693 GCAGAGAGGCAGAGGGAGTCTGG + Intergenic
1027729967 7:81858960-81858982 GCAGGTAATCGGGATGAGTCAGG + Intergenic
1027729983 7:81859065-81859087 GCAGGTAATCCGAATGAATCAGG + Intergenic
1028356257 7:89913722-89913744 GCAGAGAGTGAGAATGAGGGAGG + Intergenic
1028793325 7:94877847-94877869 GCAGGTGATCAGAATGAGTCAGG - Intergenic
1028793337 7:94877936-94877958 GCAGGTGATCAGAATGAGTCAGG - Intergenic
1028793916 7:94883028-94883050 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1028793921 7:94883056-94883078 GCAAGTAATCAGAATGAGTCAGG - Intergenic
1030167460 7:106569618-106569640 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1031985826 7:128164167-128164189 GGAGAGAATCAGAATGACTCAGG - Intergenic
1033092892 7:138403315-138403337 GCAGGTGATCAGAATGAGTCAGG - Intergenic
1033096442 7:138435705-138435727 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1033096446 7:138435733-138435755 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1033096820 7:138439459-138439481 GCAGATAATCAGAATGAGTCAGG + Intergenic
1033098446 7:138450492-138450514 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1036552976 8:9831499-9831521 GCTGATTGTCAGAACGAGCCTGG + Intergenic
1037412686 8:18615188-18615210 GCAGGTGATCAGAATGAGTCAGG - Intronic
1038576826 8:28711791-28711813 GCAGAAAGGGAGGATGAGTCAGG + Intronic
1039006076 8:33038665-33038687 GCAGGAAATCGGAATGAGTCAGG - Intergenic
1039327245 8:36498955-36498977 GCAGTTAGTTAAAAAGAGTCTGG + Intergenic
1040074317 8:43213664-43213686 GCAGGTTGTTAGAAAGAGTCTGG + Intergenic
1041479185 8:58299155-58299177 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1041919294 8:63165031-63165053 GTAGGTAATCAGAATGAGTCAGG - Intergenic
1041919298 8:63165059-63165081 GCAGGTAATTGGAATGAGTCAGG - Intergenic
1042087016 8:65120506-65120528 GCAGGTAACCAGAATGAGTTAGG + Intergenic
1042087021 8:65120534-65120556 GCAGGTGATCAGAATGAGTCAGG + Intergenic
1042088509 8:65133348-65133370 GCAGGTGATCAGAATGAGTTAGG + Intergenic
1042230691 8:66551457-66551479 CCAGAGAGTCATAGTGAGTCTGG - Intergenic
1042724902 8:71863056-71863078 GCAGATAGTATGAATCTGTCTGG + Intronic
1042927801 8:73984222-73984244 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1043598401 8:81911587-81911609 GCAGCTGATCAGGATGAGTCAGG + Intergenic
1043720857 8:83545773-83545795 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1044061062 8:87636369-87636391 GCAGGTAATCGGAATGACTCGGG - Intergenic
1044184325 8:89234219-89234241 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1044268040 8:90206240-90206262 GCAGATGATCAGAATGAGTTAGG - Intergenic
1044268043 8:90206268-90206290 GCAGGTAATCAGAATGAGTTAGG - Intergenic
1044329203 8:90896736-90896758 GTAGGTAATCAGGATGAGTCAGG - Intronic
1044329208 8:90896764-90896786 GTAGGTAATCGGAATGAGTCAGG - Intronic
1044329216 8:90896820-90896842 GCAGGTAATCAGAATGAGTTAGG - Intronic
1044639109 8:94359993-94360015 GCAGATACTCACCATGGGTCAGG + Intergenic
1045104506 8:98878462-98878484 GTAGGTAATCAGAATGAGTCAGG - Intronic
1046441547 8:114261710-114261732 GCAGGTAATCTGAATGAGTCAGG + Intergenic
1048388268 8:133934400-133934422 GCAGGAAATCATAATGAGTCAGG - Intergenic
1048546951 8:135396255-135396277 GCAGGCAGTTGGAATGAGTCAGG - Intergenic
1048857858 8:138699264-138699286 GCAGGTAGACAGACTGAGTCAGG - Intronic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1050276125 9:4002631-4002653 GCAGCAAGACAGAATGAGTGGGG - Intronic
1050442101 9:5675304-5675326 GTAGGTAATCGGAATGAGTCAGG + Intronic
1050595150 9:7197604-7197626 GAACATCTTCAGAATGAGTCTGG - Intergenic
1051261412 9:15268912-15268934 GTAGATAGGGAGAATGAGTTTGG - Intronic
1051916484 9:22214829-22214851 TGAGATTGTTAGAATGAGTCAGG + Intergenic
1052648774 9:31273047-31273069 GCAGATGATTGGAATGAGTCAGG - Intergenic
1052648783 9:31273103-31273125 GCAGGTAATTGGAATGAGTCAGG - Intergenic
1053110520 9:35455776-35455798 GCAGGTGATCAGAATGAGTCAGG + Intergenic
1053111309 9:35461945-35461967 GCAGGTGATCAGAATGAGTCAGG + Intergenic
1053636081 9:40006241-40006263 GCAGAAGGTAAGAATGATTCTGG + Intergenic
1053769904 9:41458406-41458428 GCAGAAGGTAAGAATGATTCTGG - Intergenic
1054316956 9:63603341-63603363 GCAGAAGGTAAGAATGATTCTGG + Intergenic
1054548579 9:66369886-66369908 GCAGAAGGTAAGAATGATTCTGG - Intergenic
1056415091 9:86367818-86367840 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1056642243 9:88381480-88381502 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1056642249 9:88381536-88381558 GTAGATAATCAGAATGAGTCAGG + Intergenic
1056646743 9:88419204-88419226 GCAGGTAATCAGAATGAGCCAGG - Intronic
1056646750 9:88419249-88419271 ACAGGAAATCAGAATGAGTCAGG - Intronic
1057925023 9:99138703-99138725 GCAGGGAGTCAGAATGAGTGGGG + Intronic
1059024785 9:110614801-110614823 GCAGTTAATCGGAATGAGTGAGG + Intergenic
1059024793 9:110614857-110614879 GCAGGTAATCAGAATGAGTCAGG + Intergenic
1060571577 9:124645343-124645365 GCAGATTGTTAGAGTGAATCAGG + Intronic
1061064365 9:128268236-128268258 GAAGATTGTTAGAATGAGTTTGG - Intronic
1062167846 9:135117101-135117123 GCAGTTAGGCAGAGGGAGTCTGG - Intronic
1185582642 X:1222743-1222765 GCATGTAATCGGAATGAGTCAGG + Intergenic
1186309072 X:8297653-8297675 GCAGATTATCAGAATGAGGTAGG - Intergenic
1189034791 X:37484458-37484480 GCAGGTAATCAGAATGAGTCAGG - Intronic
1189034795 X:37484486-37484508 GTAGGTAATCGGAATGAGTCAGG - Intronic
1189034800 X:37484514-37484536 GCAGGTCATCGGAATGAGTCAGG - Intronic
1189833099 X:44994882-44994904 GCAGGTAATTGGAATGAGTCAGG + Intronic
1189833627 X:44999489-44999511 GTAGGTAATCAAAATGAGTCAGG + Intronic
1189955537 X:46273754-46273776 GCAGGTGATCAGAATGAGTCAGG - Intergenic
1189955546 X:46273810-46273832 GCAGGTAATCCGAATGAGTTAGG - Intergenic
1190771810 X:53521075-53521097 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1190771815 X:53521109-53521131 GCAGGAAATCGGAATGAGTCAGG - Intergenic
1190957200 X:55207537-55207559 GCAGACAGTCACCCTGAGTCAGG + Intronic
1191889739 X:65927633-65927655 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1191890334 X:65932754-65932776 TCAGGAAATCAGAATGAGTCAGG + Intergenic
1191890341 X:65932799-65932821 GCAGGTAATTGGAATGAGTCCGG + Intergenic
1191890345 X:65932827-65932849 GCAAACAATCAGAATGAGTCAGG + Intergenic
1191890349 X:65932855-65932877 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1193145989 X:78076186-78076208 GCAGGAAATCAGAATGAGTCAGG + Intronic
1193145997 X:78076231-78076253 GGAGGTAATCAAAATGAGTCAGG + Intronic
1193146001 X:78076259-78076281 GCAGGTAATCAGAGTGAGTCAGG + Intronic
1193539710 X:82756488-82756510 ACAGGTAATCGGAATGAGTCAGG - Intergenic
1194058369 X:89164787-89164809 GCAGGTGATCGGAATGAGTCAGG + Intergenic
1195019098 X:100808485-100808507 GCAGGTGATCAGAATGAGTCAGG + Intergenic
1195846640 X:109236294-109236316 GCAGGTGATCAGAATGACTCAGG + Intergenic
1196972399 X:121124048-121124070 GCAGAGAGACAGAAAGAGTGAGG - Intergenic
1197213854 X:123850060-123850082 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1197243874 X:124148355-124148377 GCAGGTAATCGGAATGAGTCAGG - Intronic
1197243882 X:124148400-124148422 GCAGGAAATCAGAATGAGTCAGG - Intronic
1197268776 X:124403790-124403812 GCAGGTAATCGGAATGAGTCAGG - Intronic
1197268785 X:124403846-124403868 GCAGGTAATCTGAATGAGTTAGG - Intronic
1198742652 X:139857450-139857472 GCAGGTGATCGGAATGAGTCAGG - Intronic
1198868894 X:141155353-141155375 GCAGGTGATCAGAATGAGTCAGG - Intergenic
1198868898 X:141155381-141155403 GCAGGAAATCAGAATGAGTCAGG - Intergenic
1198868902 X:141155409-141155431 GCAGGAAATCAGAATGAGTCAGG - Intergenic
1198948536 X:142042206-142042228 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1198948545 X:142042262-142042284 GCAGGTGATCAGAATGAGTCAGG + Intergenic
1198965610 X:142226574-142226596 GCAGGAAATCAGAATGAGTCAGG + Intergenic
1199637181 X:149825214-149825236 GCAGGTAATCTGAATGAGTTAGG - Intergenic
1199638525 X:149836764-149836786 GCAGGTGATCAGAATGAGTTAGG - Intergenic
1199638529 X:149836792-149836814 GCAGGTAATCTGAATGAGTTAGG - Intergenic
1200763019 Y:7057088-7057110 GCAGGTAATCAGGATGAGTCAGG + Intronic
1200763023 Y:7057116-7057138 GCAGGTAATCAGAATGAGTCAGG + Intronic
1200763034 Y:7057172-7057194 GCAGGTAATCAGAATGAGGGTGG + Intronic
1200763802 Y:7063488-7063510 GCAGAAAATCGGAATGAGTCAGG + Intronic
1200763806 Y:7063516-7063538 GTAGGTAATCGGAATGAGTCAGG + Intronic
1200763810 Y:7063544-7063566 GTAGGTAATCGGAATGAGTCAGG + Intronic
1200763814 Y:7063572-7063594 GCAGGTAATCTGAATGAGTCAGG + Intronic
1200769130 Y:7107398-7107420 GCAGGTAATCAGAATGAGTCAGG + Intergenic
1200769465 Y:7110233-7110255 GCAGGTAATTGGAATGAGTCAGG - Intergenic
1200769470 Y:7110261-7110283 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1201362521 Y:13168427-13168449 GTATGTAATCAGAATGAGTCAGG - Intergenic
1201362524 Y:13168455-13168477 GCAGGTAATCAGGATAAGTCAGG - Intergenic
1201362531 Y:13168511-13168533 ACAGGTAATCAGAATGAGTCAGG - Intergenic
1201384926 Y:13429683-13429705 GCAGGCAATCAGAATGAGTCAGG - Intronic
1201474220 Y:14363397-14363419 GCAGGTAATCAGAATGAGTTAGG + Intergenic
1201474225 Y:14363425-14363447 GCAGGTGATCAGAATGAGTCGGG + Intergenic
1201900351 Y:19041917-19041939 GCAGGAAATCAGAAAGAGTCAGG + Intergenic
1201900358 Y:19041962-19041984 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1201900819 Y:19044978-19045000 GCAGGTATTTGGAATGAGTCAGG - Intergenic