ID: 1087643538

View in Genome Browser
Species Human (GRCh38)
Location 11:100781542-100781564
Sequence CCAAGCACCGAGAATTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087643538 Original CRISPR CCAAGCACCGAGAATTTGTC AGG Intronic
900721641 1:4179900-4179922 CCAAGCAGGGAGACTTGGTCGGG + Intergenic
903473032 1:23600562-23600584 CAAACCACCGAGAATCTGCCTGG - Intronic
906728128 1:48058841-48058863 ACAATCACCTTGAATTTGTCTGG + Intergenic
907570000 1:55474406-55474428 CTAAGCACCCAGTATGTGTCAGG + Intergenic
910745472 1:90569647-90569669 CACAGCACAGAGATTTTGTCTGG - Intergenic
912496624 1:110095850-110095872 CCAAGAACAGAGATTCTGTCTGG - Intergenic
921824146 1:219652951-219652973 TCAAGCAGAGAGAATTTGTTGGG - Intergenic
922085953 1:222347065-222347087 CCAGGCACTGAGATTTTGCCAGG + Intergenic
923083899 1:230687146-230687168 CCAAGCACCTGGAATTATTCTGG - Intronic
924240871 1:242039068-242039090 CCAAGCACAGAGGATTTTTAGGG - Intergenic
924797519 1:247302703-247302725 CCAAGCTCAGAGAAGCTGTCTGG - Intronic
1067197203 10:44132448-44132470 CCAAGCACCAAGAGTGTATCAGG + Intergenic
1068153961 10:53171227-53171249 CCAAGCACAGACATTTTTTCTGG - Intergenic
1068191934 10:53663945-53663967 TCAAGCAGCCAGAATTTCTCTGG - Intergenic
1072041511 10:91611256-91611278 CCAAGCAACAAGAGTTTGTGAGG - Intergenic
1076119715 10:127925760-127925782 CCAAGCAGTTAGGATTTGTCAGG - Intronic
1080552340 11:33383559-33383581 TCAAGCACCCAGCATGTGTCAGG + Intergenic
1081597518 11:44469238-44469260 CAAAGTACCTAGAATATGTCAGG + Intergenic
1082718828 11:56648178-56648200 CCAAGCAACAAGCATTTATCGGG + Intergenic
1086871256 11:92039657-92039679 CCAAGCACCTAATATTTGCCAGG + Intergenic
1087643538 11:100781542-100781564 CCAAGCACCGAGAATTTGTCAGG + Intronic
1087803741 11:102533366-102533388 CAAAGCACAGAGAATTTCTGGGG + Intergenic
1088407125 11:109494357-109494379 TCAAGCACAGAGAATTTGGGGGG + Intergenic
1088407185 11:109494926-109494948 TCAAGCACAGAGAATTTGGGGGG + Intergenic
1106551143 13:30772105-30772127 CCAGGCACCGACAGATTGTCTGG - Intergenic
1108495908 13:51025215-51025237 CCAAGCCCTGGGAATTTCTCAGG + Intergenic
1108945390 13:56016942-56016964 CAGAGCACAGAGAATTTGTAGGG - Intergenic
1117354862 14:54914020-54914042 CCAAGCACCTAGAATATGTTGGG - Intergenic
1123859981 15:24455445-24455467 CCATGCAGCTAGAGTTTGTCTGG - Intergenic
1126419181 15:48453514-48453536 CAAAGCACAGAGAATTTTTAGGG + Intronic
1127976042 15:63998111-63998133 CTAAGCACCAAGGATATGTCAGG - Intronic
1128463678 15:67890715-67890737 CCAACCAGCACGAATTTGTCAGG + Intergenic
1134754660 16:16655998-16656020 CCAAGCATGGAGAATTTTCCCGG + Intergenic
1134991401 16:18703044-18703066 CCAAGCATGGAGAATTTTCCCGG - Intergenic
1138882460 16:61032160-61032182 CAAGGCAACGAGAATTTGTAGGG - Intergenic
1141101055 16:81197816-81197838 CCACGCACGGAGAATTTTTTTGG - Intergenic
1142254296 16:89006592-89006614 CCAAGCAGGGAGCATCTGTCTGG - Intergenic
1143331368 17:6138464-6138486 CCAGGCTCAGAAAATTTGTCAGG + Intergenic
1143407081 17:6684793-6684815 TCAAGGACCGAGTATGTGTCTGG - Exonic
1143648710 17:8249181-8249203 CCAAGAACCTAGAATTCGGCCGG + Intronic
1147250511 17:39150514-39150536 CTAAGCACCTAGACTTTCTCTGG - Intronic
1147405364 17:40207834-40207856 CCAAGCACAGCTAATTTTTCTGG + Intergenic
1157564206 18:48668711-48668733 CCAAGCACAGGGAATTTGGGAGG - Intronic
1158186187 18:54774473-54774495 CCAAACACAGAGCATTTGACAGG + Intronic
1164467184 19:28497293-28497315 CCAACCACAGAGAATTTTTTTGG - Intergenic
1167443030 19:49520678-49520700 CCAAGCACAGAAAATCTGTCTGG - Intronic
928174698 2:29025871-29025893 CCAAGCACCAGGGATGTGTCAGG + Intronic
930685492 2:54303053-54303075 CCAAGCACTAACAATTTGTTCGG - Intronic
931436812 2:62254756-62254778 CCAAGCACTTAGAGTGTGTCTGG + Intergenic
934945248 2:98536561-98536583 CCAGACACCTAGAATGTGTCTGG + Intronic
941135597 2:161714258-161714280 ACAAGCACTGAAAATTTGTTGGG - Intronic
1169095588 20:2895670-2895692 CCAAACACCTGGAATTAGTCTGG + Intronic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1182437035 22:30337414-30337436 CCAAGCAACAAGCATTTCTCAGG + Intronic
1184601278 22:45544857-45544879 CCAAGCACCTAGTATGTGCCAGG - Intronic
957145927 3:76423649-76423671 GCAAGCACCCAGAAATTCTCAGG - Intronic
958710423 3:97710427-97710449 CCAAGCACTGTGGATCTGTCAGG + Intronic
959854902 3:111141048-111141070 CCAAGCACCTAGTATGTGTCAGG - Intronic
960860391 3:122146907-122146929 CCAAGCCCAGAGTATTTATCTGG - Intergenic
965467237 3:169045270-169045292 CCAAGCATCTAGAATGTGTTCGG + Intergenic
967017131 3:185492642-185492664 CCAAGTACCCAGAATTTCTGGGG - Intronic
967110925 3:186293246-186293268 CAAAGCACCGAGGATTTTTAGGG - Intronic
975262709 4:72322609-72322631 CCAAGCACCTAGAAAATGTCTGG + Intronic
977100226 4:92802422-92802444 CAAAGCACAGAGAATTTTTAGGG - Intronic
978326440 4:107562442-107562464 CCAAACTCTGAGAATGTGTCTGG + Intergenic
979928853 4:126604056-126604078 CTAAGCACCGTGGATTTCTCGGG + Intergenic
985194653 4:187416014-187416036 ACAAGCACTTAGAATTTTTCAGG - Intergenic
987465355 5:18265703-18265725 CCAGGCACCAAAAATCTGTCTGG - Intergenic
987753981 5:22076464-22076486 TCAAAAACAGAGAATTTGTCAGG + Intronic
996656297 5:125940837-125940859 CCAAGCACAGAGAATTTTTAGGG + Intergenic
997149895 5:131481923-131481945 CCAATCACAGAGAATTTTTTTGG + Intronic
1001211861 5:169817374-169817396 CTAAGCACCTATGATTTGTCAGG + Intronic
1005633306 6:27729506-27729528 CCAAGCACAGAGAATTTTTAAGG - Intergenic
1006737061 6:36281423-36281445 CCAAGCACTTAGAATGTGCCAGG + Intronic
1012464013 6:99497055-99497077 CAAAGCACAGAGAATTTTTTAGG - Intronic
1013549576 6:111194059-111194081 CCCAGCACCTAGAATGTGCCTGG + Intronic
1015873001 6:137795872-137795894 CAAAGCACAGAGAATTTTTAGGG - Intergenic
1019137154 6:169916854-169916876 CTAAGCACAGAGAGTATGTCAGG - Intergenic
1020135844 7:5587424-5587446 CCATGCAGCCAGAAATTGTCAGG + Intergenic
1021046775 7:15932726-15932748 CCAGGGACAGAGAATTTGCCAGG + Intergenic
1027480595 7:78691769-78691791 CAAAGCACAGAGAATTTTTAGGG + Intronic
1028282031 7:88942601-88942623 TCAAGCACCTAGAATATGCCAGG - Intronic
1028684571 7:93576814-93576836 CCAAACATTGAGAATTTCTCAGG + Intergenic
1030290438 7:107867006-107867028 CAAAGCACAGAGGATTTGTAGGG + Intergenic
1031788067 7:126059487-126059509 CCAAGAATCAAGAATTTGGCGGG + Intergenic
1032724502 7:134578092-134578114 CCAAGCACCTAGAAAATGCCTGG - Intronic
1032952927 7:136937097-136937119 CCAAAGACAGAGAATTTGACTGG + Intronic
1040417294 8:47206610-47206632 CCAAGCAAGGAGAATCTGGCGGG + Intergenic
1042558724 8:70056293-70056315 GCAAGCACCGAGAGTTTGCCAGG + Intronic
1048039465 8:130711405-130711427 CCTAGCACCTAGAATATGCCTGG + Intergenic
1053519435 9:38763200-38763222 CCAAGCAAGGAGAATTGGGCAGG - Intergenic
1054370103 9:64385907-64385929 CATAGCACAGAGAATTTTTCGGG - Intronic
1058536739 9:105968555-105968577 CTAAGCACCTAGAATGTGCCAGG - Intergenic
1187021057 X:15382367-15382389 ACAAGCACCAAGAATGTCTCAGG - Intronic
1193724593 X:85024510-85024532 CCAAGCAACTAGACTTTATCTGG - Intronic
1193889622 X:87028715-87028737 CCATGCACAGAGAATTCCTCTGG + Intergenic
1195674646 X:107498686-107498708 CAAAGCACTGAGAATTTCTTGGG - Intergenic
1198884602 X:141320693-141320715 CCTAGCTCCAAGAATTTTTCTGG + Intergenic