ID: 1087646441

View in Genome Browser
Species Human (GRCh38)
Location 11:100813589-100813611
Sequence GCAGAGAGTGAGAGTGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 517}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087646440_1087646441 27 Left 1087646440 11:100813539-100813561 CCAATGTATAGATGGTATTTAAA 0: 1
1: 1
2: 6
3: 28
4: 369
Right 1087646441 11:100813589-100813611 GCAGAGAGTGAGAGTGAATTAGG 0: 1
1: 0
2: 4
3: 53
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087646441 Original CRISPR GCAGAGAGTGAGAGTGAATT AGG Intronic
900238029 1:1601638-1601660 GCAGAGAGTGATGGTGACTCAGG + Intergenic
902112614 1:14095242-14095264 GATGAGAGTGAGAATGAAATGGG - Intergenic
902219469 1:14955741-14955763 GCAGAGAGTGAGATGGAGCTGGG - Intronic
904365488 1:30008384-30008406 GCAGACACTAAGAGGGAATTTGG - Intergenic
904963645 1:34354834-34354856 GCAGAGAGAGAGGTTGAGTTGGG - Intergenic
905127545 1:35726080-35726102 TGAGAGAGTGAGATTGAGTTTGG - Intronic
907558506 1:55366822-55366844 GCAGAGAGAGAGAGAGAGGTAGG - Intergenic
907745961 1:57213834-57213856 CCAGAGAGAGAAAGTGGATTGGG - Intronic
908331567 1:63075719-63075741 GCAGAGACTGAGAATGTCTTTGG - Intergenic
909533116 1:76702983-76703005 ACAGAGAGAGAGAGAGAATACGG + Intergenic
909796791 1:79749751-79749773 AGAGAGAGAGAGAGAGAATTAGG + Intergenic
910029388 1:82699072-82699094 GCATAGAGTGTGAGTGAGTGAGG - Intergenic
910114986 1:83722057-83722079 GCAGAGAGAGAGAGCGAACAGGG - Intergenic
910481308 1:87661272-87661294 CCATAGAGTGAGACTGATTTTGG + Intergenic
911040256 1:93585548-93585570 GCACAGAGTGGGAGTGTATTCGG - Intronic
911536615 1:99107616-99107638 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
911589124 1:99726175-99726197 GGAGAGAGAGAGAGTGAAGGTGG - Intronic
912171668 1:107108030-107108052 ACAGAGAGAGAGAATGTATTTGG - Intergenic
912776138 1:112507682-112507704 CCAAAGACTGACAGTGAATTTGG + Intronic
912958495 1:114173846-114173868 GCAGAGAGTTAGATTTAATCAGG + Intergenic
913065371 1:115247708-115247730 GCAGACATTGAGACGGAATTTGG + Intergenic
913328974 1:117651613-117651635 ACAGGGAGTGAGAGAGAAGTTGG + Intergenic
914446058 1:147751534-147751556 GCAGAGCACTAGAGTGAATTGGG - Intergenic
914786513 1:150837329-150837351 GTTTAGAGTGAGAGTGAAGTGGG - Intronic
915371232 1:155352330-155352352 GCAGAGAGTGTGATTTATTTTGG + Intronic
915620213 1:157077650-157077672 GGAGGAAGGGAGAGTGAATTTGG - Intergenic
916244957 1:162678011-162678033 GGGAAGAGGGAGAGTGAATTTGG + Intronic
917180430 1:172290798-172290820 GGAGAAATTGAGAGTGAAGTAGG + Intronic
917263121 1:173191030-173191052 TCAGGGAGTGAAAGTAAATTTGG - Intronic
917624160 1:176829267-176829289 GGAGAGAATGAGAGAGAATGGGG + Intronic
918595706 1:186290301-186290323 TGAGTGAGTGAAAGTGAATTGGG - Intergenic
918595869 1:186292458-186292480 GCAGAGAGTGAGAGAGCATCTGG + Intergenic
918634146 1:186754955-186754977 AGAGAGAGAGAGAGTGATTTAGG + Intergenic
919069744 1:192738738-192738760 CCAGAGACTGAGATTCAATTGGG + Intergenic
919611071 1:199746295-199746317 GTAGAGAGAGAGAGTGGATCTGG - Intergenic
920851551 1:209631564-209631586 CCTGAGATTCAGAGTGAATTGGG - Intronic
920901614 1:210114828-210114850 GCAGAGAATGAGGAAGAATTGGG + Intronic
921771571 1:219046860-219046882 GGAGAGAGGGAGAGTGAAGGAGG + Intergenic
921974277 1:221184490-221184512 GCAGAGAGAGAGAGAAAGTTTGG + Intergenic
922354288 1:224761391-224761413 GCAGATAGTGATAGTGAAATTGG + Intergenic
923319697 1:232818882-232818904 TGAGAGAATGAGAGTGAATATGG + Intergenic
923420863 1:233813556-233813578 GCAGAGAGAGAGAGAGAAGGGGG + Intergenic
923973216 1:239228854-239228876 GAAGAGAGTGAGTGAGAATGAGG + Intergenic
924033727 1:239913834-239913856 GCAGAGACGGATAGTGTATTTGG + Exonic
924377961 1:243433032-243433054 GCAGAAAATGATAGTGAACTGGG + Intronic
924485596 1:244480790-244480812 GCAGTGAGTGAGAGAGGACTGGG - Intronic
1063795141 10:9506290-9506312 AGAGAGAGAGAGAGAGAATTAGG + Intergenic
1064640837 10:17414365-17414387 GCAGAGAGTGAGTGTGGAGGTGG - Intronic
1064786961 10:18908592-18908614 ACAGAGAATGAGAGTGAAAAAGG - Intergenic
1067486545 10:46655947-46655969 GAAGAGAGAGAGAGAGAAATTGG - Intergenic
1067608207 10:47685711-47685733 GAAGAGAGAGAGAGAGAAATTGG + Intergenic
1068033758 10:51735027-51735049 GCAGAGTGAGATAGGGAATTAGG + Intronic
1069539222 10:69281069-69281091 TGAGAGAGTGAGAGAGAACTGGG + Intronic
1070318799 10:75338893-75338915 GCAAAGAGCGAGAGTGACTTGGG - Intergenic
1071557595 10:86617074-86617096 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
1071623792 10:87147356-87147378 GAAGAGAGAGAGAGAGAAATTGG + Intronic
1071842370 10:89485649-89485671 ACAGAGACTGAGAGGGCATTTGG + Intronic
1071859965 10:89662349-89662371 GAAGAGAGGGAGAGTCAAGTGGG + Intergenic
1072317251 10:94215004-94215026 GCAGAGGGTGAGAGTGTGGTGGG - Intronic
1072564607 10:96607184-96607206 GCAGAGAGGGAGAGTGAGGATGG - Intronic
1074290230 10:112132778-112132800 AGAGAGAGAGAGAGAGAATTGGG - Intergenic
1074340308 10:112622008-112622030 ACAGAGAGAGAGAGAGAGTTGGG + Intronic
1075207335 10:120458279-120458301 GCAGAGAGGGGGAGAGAATTTGG - Intronic
1075452543 10:122562076-122562098 GGAGAGAGAGAGAGAGAAATAGG - Intronic
1075951596 10:126482477-126482499 GCAGAGAGAGAAGGTGAAGTTGG - Intronic
1077346616 11:2061038-2061060 GCAGAAAGGGGGAGGGAATTTGG - Intergenic
1078838942 11:15059622-15059644 ACAGGGAGAGAGAGTCAATTTGG + Intronic
1078942089 11:16018395-16018417 GTGGAGAGAGAGAATGAATTTGG + Intronic
1079601370 11:22316119-22316141 GGAGAGAGAGAGAGAGAGTTTGG - Intergenic
1079875289 11:25848691-25848713 GCAGAGAGTGAGAGTGTAGTGGG + Intergenic
1080796512 11:35568389-35568411 GCATAGAGAGAGAGAGAGTTTGG + Intergenic
1080843208 11:36003892-36003914 GGAGAGAGAGAGAGTGAAGGGGG + Intronic
1081043090 11:38235848-38235870 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
1081110975 11:39132819-39132841 ACACAGAGGGAGAGTGAGTTAGG - Intergenic
1081201796 11:40225600-40225622 AAAGAGAGAGAGAGAGAATTGGG - Intronic
1081270387 11:41076476-41076498 GGAGAGCGAGAGAGTGAAGTGGG + Intronic
1081341300 11:41931061-41931083 CCAGAGAGAGAGAGAGATTTTGG + Intergenic
1082733244 11:56825751-56825773 ACAGAGAGAGAGAGAGAGTTGGG + Intergenic
1082782667 11:57299832-57299854 GCAGAGAGGGAGAGGGAAGGAGG + Exonic
1082983488 11:59145198-59145220 GAAGAGAGGGAGAGTGAAGGAGG + Exonic
1084545270 11:69812239-69812261 GCAGAGAGAGAGAGTGGAAATGG + Intronic
1086979711 11:93180249-93180271 GAAGAGATTGACAGTGTATTTGG - Intronic
1087284958 11:96255475-96255497 GCAGCAAGTGAGAGGGGATTGGG - Intronic
1087495793 11:98889827-98889849 GTAGAGAGAGAGAGTGAATGGGG + Intergenic
1087646441 11:100813589-100813611 GCAGAGAGTGAGAGTGAATTAGG + Intronic
1088536812 11:110870368-110870390 GTAGAGAGAATGAGTGAATTGGG - Intergenic
1089867136 11:121641982-121642004 GCAGAGACTGAGGAAGAATTGGG + Intergenic
1089953175 11:122548265-122548287 GCAGAGACTGAGGAAGAATTGGG - Intergenic
1090632427 11:128661451-128661473 GCACACAGTGAGAGGGAATTGGG + Intergenic
1092704592 12:11268604-11268626 AAACAGATTGAGAGTGAATTGGG + Intronic
1092757094 12:11773974-11773996 GAAGAGAGAGAGAGTGAAGCGGG + Intronic
1093082261 12:14826666-14826688 GCAGAGAGTGAGGGGTAATGTGG - Exonic
1093807861 12:23456729-23456751 GAAGAGAGTCACAGTGATTTAGG + Intergenic
1094104217 12:26792742-26792764 ACAAAGAGGGAGAGTTAATTGGG - Intronic
1094415291 12:30209453-30209475 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
1094568786 12:31624013-31624035 GCAGAAGATGAGAGAGAATTAGG - Intergenic
1095367255 12:41422590-41422612 GGAGAGAGAGAGAGTGGATGAGG + Intronic
1097241643 12:57579696-57579718 ACAGAGAGGGAAAGTGAATGCGG - Intronic
1098521010 12:71435630-71435652 GGAGAGAGAGAGGGTGAATGGGG + Intronic
1098571996 12:71998214-71998236 ACAGAAAGTCAGAGTGAGTTGGG - Intronic
1098708504 12:73722838-73722860 AGAGAGAGTGAGAGAGAATATGG + Intergenic
1098885727 12:75958971-75958993 GCAGAGAGTGAGGGTGAATGAGG + Intergenic
1099389964 12:82068248-82068270 AGAGAGAGAGAGAGTGATTTTGG + Intergenic
1099475473 12:83103485-83103507 GGAGAGAGTGAGAGTGAGGGAGG + Intronic
1099675615 12:85756573-85756595 GGAGGGAGAGAGAGTGAAGTGGG - Intergenic
1099953381 12:89328506-89328528 AGAGAGAGTGAGAGTGAGTATGG - Intergenic
1100262010 12:92941334-92941356 GAAGAGAGAGAGAGTGAAAGGGG - Intergenic
1100672458 12:96831566-96831588 ACAGAGAGTGACAGGGAATGGGG + Intronic
1100737778 12:97556587-97556609 GCAGAGAATGCTATTGAATTTGG - Intergenic
1100961876 12:99971389-99971411 GCAGTGAGTGGGAGTGTGTTTGG - Intronic
1101059714 12:100958334-100958356 AAAGAGAGAGAGAGTGAAATGGG - Intronic
1102751590 12:115299417-115299439 ACAGAGACTGACAGAGAATTTGG - Intergenic
1102809570 12:115812748-115812770 GCAGAGAGTGAGGGAGAACAGGG - Intergenic
1103452906 12:121042045-121042067 GCAGAGAGTGGAAGGGAATGCGG + Intergenic
1104230260 12:126877626-126877648 ACAGAGAGAGAGAGAGAATTTGG - Intergenic
1104378939 12:128290337-128290359 GGAGAGAGAGAGAGTGAAGGGGG + Intronic
1104516419 12:129431308-129431330 GCAGAGAGGGAGAACGATTTGGG - Intronic
1106168371 13:27269043-27269065 GCAGAGAGTGATGGAGAATGGGG - Intergenic
1106203775 13:27569193-27569215 GCAGAGATTGAGAATGAAAATGG - Exonic
1106428410 13:29656260-29656282 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
1106541895 13:30697744-30697766 GCAGAGAGTGAAAGTGAGAGCGG + Intergenic
1106557686 13:30824462-30824484 AAAGAGAGAGAGAGTCAATTTGG - Intergenic
1107975435 13:45683880-45683902 GCAGAGAGGGATGGGGAATTGGG - Intergenic
1109414438 13:62019866-62019888 ACACAGAGAGAGAGTGGATTTGG + Intergenic
1109421066 13:62113436-62113458 ACAGAGAGAGAGAGAGAACTGGG - Intergenic
1109463287 13:62692321-62692343 GAAAAGAGTGAGAGTGAATGTGG - Intergenic
1109616104 13:64836162-64836184 GGAGAGAGTGAGAGAGAAGTGGG - Intergenic
1109634214 13:65092380-65092402 GCAGAGAGAGAGAGTGGAGTGGG + Intergenic
1109738280 13:66516711-66516733 GGAGAGAGAGAGAGAGATTTCGG - Intronic
1109810234 13:67503898-67503920 GCAAAGAGTGAGAAAGAATTCGG - Intergenic
1110166256 13:72447210-72447232 AAAGAGAATGAGAGTGAATGGGG - Intergenic
1110380529 13:74845029-74845051 AAGGAGAGTGAGCGTGAATTGGG - Intergenic
1110550892 13:76810268-76810290 GGAGAGAGAGAGAGTGAAGAGGG - Intergenic
1111669177 13:91306526-91306548 GGAGAGAGGGAGAGTGAAGGGGG - Intergenic
1111691548 13:91569392-91569414 ACAGAGAGAGAGGATGAATTAGG - Intronic
1112067878 13:95813980-95814002 GCAGAGTGCAAGAGTGAATGAGG + Intronic
1112156395 13:96822166-96822188 GCTGCCAGTGAGACTGAATTGGG + Intronic
1112876284 13:104043648-104043670 GTAGAGAGTAAGAGTCAATTTGG - Intergenic
1112944467 13:104910403-104910425 GCAGAGAGTGAGATCGAGGTAGG - Intergenic
1113035534 13:106043892-106043914 CCAGTGAGTGAGACTGAACTGGG - Intergenic
1113225226 13:108152336-108152358 GGGGAGAGAGAGAGTGAAGTGGG - Intergenic
1113246305 13:108399785-108399807 GCAGAAAGTTAGAGTGAAAAAGG + Intergenic
1113862230 13:113494595-113494617 GAAGAGAAGGAGACTGAATTGGG + Intronic
1114715258 14:24817719-24817741 GCAGAGGCAGAGAGTGAACTTGG - Intronic
1116045409 14:39736787-39736809 AAAGAGAATGAGATTGAATTGGG + Intergenic
1116613432 14:47105877-47105899 GCAGAGGCTGAGAAAGAATTGGG - Intronic
1117408185 14:55425569-55425591 GCAGAGAAAGAGAGTGGTTTTGG + Intronic
1117838133 14:59828929-59828951 GCAGAGAGAGAGATTCCATTAGG - Intronic
1117993641 14:61458757-61458779 GGAGAGAGAGAGAGTGAAGGGGG + Intronic
1118573257 14:67215533-67215555 GGAGAGAGTGAGAGTAAAGTAGG + Intronic
1118793187 14:69114851-69114873 GAAGAGAATGGGAGAGAATTGGG + Intronic
1119945244 14:78686511-78686533 AGAGAGAATAAGAGTGAATTGGG + Intronic
1120157347 14:81108334-81108356 AGAGAGAGAGAGAATGAATTAGG - Intronic
1120446882 14:84609808-84609830 GCAGAGAGAGAGATCTAATTTGG - Intergenic
1120479824 14:85036093-85036115 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
1120940346 14:89942037-89942059 GGAGAGAGAGAGAGTGAACGGGG - Intronic
1121590254 14:95100908-95100930 GCAGAGAGGGAGAGTACTTTTGG - Intronic
1121857270 14:97281741-97281763 GGAGAGAGAGAGAGAGAATAAGG + Intergenic
1122003439 14:98683438-98683460 GGAGAGAGTGAGGGTCATTTTGG - Intergenic
1122273733 14:100580529-100580551 GGAGAGAGTGAGAGTGTTTCTGG - Intronic
1124658766 15:31528392-31528414 GGAGAGAGGGAGAGTGAAAAGGG + Intronic
1124733290 15:32218891-32218913 GAAGAGAGAGAGAGTGAAGGGGG + Intergenic
1124818717 15:33021422-33021444 GCATAGAGAGAGAGAGAAGTTGG - Intronic
1124916744 15:33982793-33982815 CCAGAGAGAGAGAGAGAATGTGG - Intronic
1125447688 15:39775701-39775723 GGAGAGAGAGAGAGTGAAGGAGG - Intronic
1125492069 15:40155721-40155743 CAGGAGAGTGAGAGTGCATTCGG - Intergenic
1127633602 15:60848730-60848752 GGAGAGAGAGAGAGTGAAGGGGG + Intronic
1127871577 15:63078268-63078290 GCAGTGGGCGAGAGAGAATTGGG + Intergenic
1128204369 15:65837747-65837769 GGAGAGAGAGAGAGTGAGTTTGG - Intronic
1128886840 15:71295807-71295829 GCAGGGAGTGGGAGTGGATGGGG - Intronic
1129698371 15:77753561-77753583 GCTGAGAGAGAGAGTTTATTTGG + Intronic
1129706717 15:77798562-77798584 GCAGAGCGTGACAATGATTTGGG + Intronic
1129947694 15:79555200-79555222 GGAGTGAGGGAGAGTGAAATGGG - Intergenic
1131544045 15:93300892-93300914 GCAGCAAGGCAGAGTGAATTTGG + Intergenic
1133355104 16:5130428-5130450 GGAGAGAGAGAGAGAGAATTGGG - Intergenic
1133406471 16:5528587-5528609 AGAGAGAGAGAGAATGAATTGGG - Intergenic
1133553214 16:6879355-6879377 GCAGAGAGAGAGATGAAATTAGG - Intronic
1133682676 16:8134926-8134948 GCAGAGAGTTAGAGAGCCTTGGG + Intergenic
1134068010 16:11241728-11241750 GCAGAGAGATAGAGAGAGTTGGG - Intergenic
1134840141 16:17395131-17395153 GGAGAGAATGAGAGTGAAGGGGG + Intronic
1135637509 16:24091352-24091374 GCAGATAGTTAGAGTCGATTTGG + Intronic
1137467152 16:48720248-48720270 GCAGTGACTGGGAGTTAATTAGG + Intergenic
1137698912 16:50481801-50481823 ACAGAGAGAGAGAGAGAATAGGG + Intergenic
1137737347 16:50734848-50734870 GCAAAGAGTGAGAGGGAAGAAGG + Intergenic
1139351768 16:66341377-66341399 GCAGAGATTGTGACTGTATTAGG + Intergenic
1140136009 16:72206086-72206108 GAAGTGAGTGAGAGTGACTTGGG + Intergenic
1141055799 16:80812537-80812559 TCAAAGATAGAGAGTGAATTTGG + Intergenic
1141351777 16:83304796-83304818 GCTGCTAGTAAGAGTGAATTAGG + Intronic
1141402528 16:83762895-83762917 GCAGAGTGTGAGAGGGCATTTGG - Intronic
1142581527 17:946051-946073 GGAGAGAGAGAAAGTGAGTTGGG + Intronic
1142909085 17:3071806-3071828 GCAAAGAGAGAGAGAGAAATAGG + Intergenic
1143982479 17:10881921-10881943 AGAGAGAGAGAGAGAGAATTGGG + Intergenic
1144070127 17:11663562-11663584 GCAGAGAGTGAGATTGTACTTGG - Intronic
1144146985 17:12408176-12408198 GCAGAGAGTGAGGGAAAACTTGG - Intergenic
1146245044 17:31273102-31273124 GCAAAGACTGAGAGGCAATTTGG + Intronic
1146542740 17:33711675-33711697 GAAGAGAGAGAGAGTGAAGGGGG + Intronic
1146602417 17:34229480-34229502 AGAGTGAGGGAGAGTGAATTAGG - Intergenic
1146728656 17:35175552-35175574 GGAGAGAGAATGAGTGAATTTGG + Intronic
1148401598 17:47367306-47367328 TCAGAGAATCAGAGTGAATCAGG + Intronic
1148678016 17:49456269-49456291 GGAGAGAGTGAGAGTGGAGCTGG + Intronic
1149208688 17:54278711-54278733 GCAGAGACTGAGATAGAGTTTGG + Intergenic
1150337857 17:64343363-64343385 GCACAGAGGGAGAGTGAGTGTGG - Intronic
1151225973 17:72648687-72648709 GCAGAGAGGGGGAGGGAATAAGG + Intronic
1152353166 17:79794579-79794601 GGAGAGAGTGAGCGTGAGCTTGG - Exonic
1152650729 17:81491489-81491511 GCAGAGAGAGAGAGAGAAAGAGG - Intergenic
1153606242 18:6836322-6836344 GGAAAGAGTGAGAGTGAGTGAGG + Intronic
1153692034 18:7603571-7603593 GCAGAGAAGGAGAGAGAAATGGG - Intronic
1153946851 18:10026020-10026042 GAAGAGAGTGAGAGTGAGGCAGG - Intergenic
1154144380 18:11854840-11854862 GCTAAGACTGAGGGTGAATTTGG - Intronic
1154172362 18:12061086-12061108 GCAGTCAGTGGGGGTGAATTAGG + Intergenic
1154372291 18:13775081-13775103 ACAGAATGTGAGAGTGAATGAGG - Intergenic
1154959967 18:21298236-21298258 CCTGAGACTGAGAGTGAATGTGG - Intronic
1155327565 18:24680627-24680649 GGAGAGAGTGAGAGAGAAACTGG + Intergenic
1155625521 18:27829961-27829983 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
1156074672 18:33259535-33259557 GGAGAGAGAGAGAGTGAAGGCGG + Intronic
1156530245 18:37808052-37808074 GGAGAGAGAGGGAGTGAAGTGGG - Intergenic
1156907242 18:42368597-42368619 ACAGAGTGAGAGAGTGACTTGGG - Intergenic
1157058454 18:44257828-44257850 GCAGAGAGTGAAAGGGAAGTAGG + Intergenic
1157379222 18:47196158-47196180 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
1158107664 18:53904245-53904267 GCAGAGAGTGAGACTGAACAGGG - Intergenic
1158316261 18:56214161-56214183 CAAGAGAGAGAGAGTGAGTTGGG - Intergenic
1158327537 18:56327282-56327304 ACAGGGAGTGAGACTGAGTTTGG + Intergenic
1158759618 18:60369161-60369183 GCAGAGAGTGAGAGTGGGGCTGG - Intergenic
1158860971 18:61592088-61592110 GGAGAGAGAGAGAGAGAAGTGGG - Intergenic
1159834972 18:73326354-73326376 GCAGAGGCTGAGAAAGAATTGGG - Intergenic
1161513142 19:4682865-4682887 GCAGAGAGAGAGAGAGAAACAGG + Intronic
1163383466 19:16984341-16984363 AGAGAGAGAGAGAATGAATTTGG + Intronic
1164489349 19:28692446-28692468 ACAGAGCGTAAGAGTGAATGAGG + Intergenic
1164871918 19:31653070-31653092 GCAAAGACAGAGAGTGCATTAGG - Intergenic
1164881037 19:31733000-31733022 GCAGAGAGAGGGAGTGAGGTGGG - Intergenic
1165484998 19:36090147-36090169 GCAGAGAGTGAGTGTGCAGAGGG + Intronic
925135541 2:1523404-1523426 GCACAGAGTGGGAGGGATTTGGG - Intronic
925135972 2:1525131-1525153 GCACACAGTGAGGGTGATTTGGG - Intronic
925137183 2:1530024-1530046 GCAGAGAGTGGGGGTGATTTGGG - Intronic
925137613 2:1531734-1531756 ACAGAGAGTGGGGGTGATTTGGG - Intronic
925137621 2:1531763-1531785 GCAGAGAGTGGGGGTGATTTGGG - Intronic
925137629 2:1531792-1531814 GCAGAGAGTGGGGGTGATTTGGG - Intronic
925137637 2:1531821-1531843 GCAGAGAGTGGGGGTGATTTGGG - Intronic
925138300 2:1534513-1534535 GCACAGAGTGGGAGGGATTTGGG - Intronic
925230160 2:2225943-2225965 TCAGAGAGTGAGGGTGGAATGGG + Intronic
925305782 2:2847178-2847200 CCAGAGGGTGAGAGTTAATGTGG - Intergenic
925504057 2:4541298-4541320 GGAGAGAGAGAGAGAGAATTAGG - Intergenic
925530108 2:4850013-4850035 GGAGAGAGGGAGAGTGAAAGGGG + Intergenic
925684502 2:6457837-6457859 GCAGAAGGTGAAAGTGAAGTAGG + Intergenic
925932876 2:8724183-8724205 GCAGAAAGTGAGAGGGAAGGTGG + Intergenic
926478761 2:13360263-13360285 GAAAAGAGTGAAAGTGACTTTGG - Intergenic
926575473 2:14575772-14575794 ACAGAGAATGAGAGGGAAGTAGG + Intergenic
926687430 2:15709030-15709052 GCATAGAGTGATGGTGAGTTGGG - Intronic
926742001 2:16119459-16119481 GGAGAGAGAGAGAGTGAGTAGGG - Intergenic
926767506 2:16335150-16335172 GCAGATACTGAGAGGGAGTTTGG - Intergenic
926782894 2:16491580-16491602 GCAGAGAGGGAGAGAGAAAGAGG + Intergenic
926919819 2:17929388-17929410 GGAGAGAGAGAGAGTGAAGGGGG + Intronic
926943343 2:18161397-18161419 GCAGAGACTGAGAGTGAGAAAGG - Intronic
927399016 2:22689316-22689338 GAAGAGAGAGAGATTGAGTTGGG - Intergenic
928301327 2:30127713-30127735 GAATAGAGTGAGAGGGAAGTGGG + Intergenic
928422395 2:31148787-31148809 GCAGACAGAGAGAGAGAATTCGG + Intronic
929070016 2:38020513-38020535 GGAGAGGGTGAGAGGGAACTGGG + Intronic
929449168 2:42025261-42025283 GGAGAGAGGGAGAGTGAGCTAGG + Intergenic
929505253 2:42523243-42523265 GAAGAAAGGGAGAGTGGATTTGG - Intronic
930159349 2:48138260-48138282 AGAGAGAGTGAGAGAGACTTTGG + Intergenic
930276960 2:49322898-49322920 GGAGAGAGAGAGAGAGAAGTGGG - Intergenic
930814518 2:55580340-55580362 GCAGAGAGAGAGAGACAAATGGG - Intronic
931825540 2:65996693-65996715 GCAGAGAGGGAGAGTTTAATAGG - Intergenic
932736252 2:74256654-74256676 GCAGAGAGTGGGAATACATTTGG - Intronic
932907484 2:75769297-75769319 GCACAGACTGAGTGAGAATTAGG + Intergenic
934508196 2:94913324-94913346 ACAGAGGGTGAGTGTGAATGGGG - Intergenic
935649416 2:105369507-105369529 GCAATGTGTGAGAGGGAATTTGG + Intronic
936014641 2:108948618-108948640 AGAGAGAGAGAGAGTGAAGTGGG + Intronic
936151056 2:110022699-110022721 GCAGGGACTGAGAGTGGACTGGG + Intergenic
936193621 2:110348670-110348692 GCAGGGACTGAGAGTGGACTGGG - Intergenic
936616460 2:114052882-114052904 GCAGAGAAAGAGAGAGAATGGGG - Intergenic
936626696 2:114156462-114156484 GCAGAGAGTGAAAGTGCAGCAGG - Intergenic
936730202 2:115373892-115373914 AGAGAGAGAGAGAGTGAAATGGG + Intronic
936886962 2:117322057-117322079 GCTGAGAGTGAGAGGAAATGTGG + Intergenic
937077808 2:119119696-119119718 GCCCAGAGTGAGGGTGAGTTGGG - Intergenic
937725683 2:125162877-125162899 AGAGAGAGAGAGAGGGAATTTGG + Intergenic
937839829 2:126513838-126513860 GCAGGGAGTGGCAGTGATTTGGG + Intergenic
937941566 2:127290176-127290198 GCAGAAAGTGACAGTGCCTTGGG + Intronic
938765844 2:134460083-134460105 GGGGAGAGTGAGAATGAATTTGG - Intronic
938922665 2:136009394-136009416 AGAGAGAGAGAGAGAGAATTAGG - Intergenic
939623133 2:144445427-144445449 GAAGAGAGAGAGAATGAATGTGG - Intronic
939696348 2:145329468-145329490 ACAGAGAGTGAGATGGAAATTGG - Intergenic
940584070 2:155621834-155621856 AAAGAGAGTGAGGGTGAATTTGG - Intergenic
940692456 2:156936598-156936620 GCACAGAGTGAGTGTGAATTGGG + Intergenic
941181409 2:162263601-162263623 GCAGAGAGTGAGACAAACTTGGG - Intergenic
942181923 2:173388409-173388431 TCAAAGAGTGAGAGGGAGTTAGG + Intergenic
942482136 2:176400337-176400359 GCAGAGAGTAACATTGATTTGGG + Intergenic
942827977 2:180203740-180203762 GCAGAGAGTGAGACGGCATTTGG + Intergenic
943192609 2:184698706-184698728 ACAGAGAGTTACAGAGAATTTGG - Intronic
943330659 2:186555042-186555064 GCATAGACTGAGAGTGCATAGGG - Intergenic
943641985 2:190369735-190369757 GCAGAAAGGGAGTGTGAGTTAGG - Intronic
944102701 2:196045535-196045557 ACAGAGAGAGAGAGAGAATATGG + Intronic
944975530 2:205045607-205045629 GCAGATACTGATAGTGAATGAGG + Intronic
945358879 2:208871327-208871349 TAAGAGAATGAGAGTGCATTAGG + Intergenic
945612679 2:212024657-212024679 GAAGAGAGTGAGAGGTAAGTAGG - Intronic
946515007 2:220402339-220402361 GCAGAATGTAAGAGTGAATGAGG + Intergenic
946531396 2:220574233-220574255 GGAGAGAGAGAGAGTGAAGGAGG + Intergenic
946641832 2:221792327-221792349 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
946980079 2:225202569-225202591 CCAGAGAGAGACAGTAAATTAGG - Intergenic
947024094 2:225716952-225716974 GCAGACACTGAGACAGAATTTGG + Intergenic
947646627 2:231746706-231746728 ACAGAGAGTGAGAAGGAATGGGG + Intronic
947708932 2:232299022-232299044 GCTGAGAGAAAGACTGAATTTGG - Intronic
948090396 2:235288747-235288769 GCAGAAACTGAGACAGAATTAGG - Intergenic
948526484 2:238574001-238574023 GCAGGGAGTGAGTGTGCATGGGG - Intergenic
1170680528 20:18521646-18521668 GCAGAGGCTGAGAAAGAATTGGG + Intronic
1171002025 20:21424402-21424424 GAAGAGAGAGAGAGTGAAGGGGG + Intergenic
1171029262 20:21662698-21662720 GCAGATAGCGAGAGTGAGTATGG + Intergenic
1171044220 20:21795521-21795543 GCAGAGAGGAAAAGTTAATTGGG + Intergenic
1171414252 20:24966887-24966909 GCAGTGAGTGACAGGGCATTAGG + Intronic
1172171688 20:32939255-32939277 GGAGAGAGAGAGAGAGAATATGG - Intronic
1172265423 20:33608240-33608262 GCAGAGTGTCAAAGTGAACTGGG - Intronic
1173058339 20:39637533-39637555 TCAGAGTGTGAGGGTGACTTGGG + Intergenic
1173955305 20:47027646-47027668 GGAGAGATTGAGAATGAGTTTGG + Intronic
1175013457 20:55763855-55763877 GGAGAGAGAGTGAGTGAAGTGGG + Intergenic
1175050772 20:56153210-56153232 GAAGAGAGTGCGAGTGAAGGAGG + Intergenic
1175663792 20:60840723-60840745 ACAGAGAGTGAGAGGGAAAAGGG - Intergenic
1177293009 21:19139727-19139749 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
1178700251 21:34827409-34827431 GTAAAGAGTGAAAGTGTATTTGG + Intronic
1179148343 21:38788634-38788656 TGAGAGAGTGAGAGTGAAAAAGG - Intergenic
1179193377 21:39142458-39142480 ACAGAGAGAGAGAGAGAATGGGG - Intergenic
1179367572 21:40772651-40772673 ACAGAGAGGAAGAGGGAATTTGG - Intronic
1179385911 21:40941790-40941812 CCAGAGAGTGAGAGTGACCCTGG + Intergenic
1179552138 21:42150297-42150319 ACAGAGACTGAGAGTGAAGGTGG - Intergenic
1181412935 22:22737615-22737637 GCACAGTGTGTGACTGAATTTGG + Intronic
1181613016 22:24031694-24031716 GCAGAGAGTGGCTGTGAAGTGGG + Intronic
1181742305 22:24931075-24931097 GCAGAGAGTTCCAGTGAATGAGG - Intergenic
1181957032 22:26595032-26595054 GCTGAGAGTGAGTGTGACTTAGG - Intronic
1182197660 22:28535754-28535776 GGAGAGAGAGGGAGTGAAGTGGG - Intronic
1182420489 22:30246330-30246352 AGAGAGAGGGAGAGTGAATCTGG + Intronic
1182420608 22:30246885-30246907 GAAGAAAGTGAGAGTGAAGGGGG + Intergenic
1182660082 22:31918979-31919001 GCAGAGAGTGAGCTGGAACTCGG - Intergenic
1184297505 22:43534260-43534282 GGTGAGAGAGAGAGTGAAGTGGG - Intronic
1184993131 22:48183886-48183908 TCAGAGACTGAGTGTGAATTTGG - Intergenic
1185241310 22:49749045-49749067 GGAGACAGTGAGAGCTAATTAGG - Intergenic
1185263354 22:49883891-49883913 GCAGAGAGTGAGGATGACTATGG + Exonic
949109129 3:237261-237283 GCAGAGAGACAGAGTGAGTGGGG - Intronic
949429294 3:3956873-3956895 GCACAGACAGGGAGTGAATTGGG - Intronic
950117300 3:10459637-10459659 GCAGACAGTGGGAGAGAATGAGG - Intronic
950586659 3:13897034-13897056 GAAGAGATTGTGAGTGAATTAGG - Intergenic
951097405 3:18648070-18648092 GCTGAGAGTAAGAGATAATTAGG - Intergenic
951799179 3:26576103-26576125 GGAGAGAGACAGAGTGAAGTGGG + Intergenic
951940835 3:28077131-28077153 GCAGAAATTTAGAGTGAAGTTGG + Intergenic
952725479 3:36579774-36579796 GAAGGGAGTGAGATTGAATTGGG + Intergenic
953076185 3:39572513-39572535 GCAAAGAGTGAAACTGCATTCGG + Intergenic
955420690 3:58734121-58734143 AGAGAGAGAGAGAGTGAATGTGG - Intronic
955473716 3:59313646-59313668 CCAGAGAGAGAGAGTGGCTTCGG + Intergenic
956255826 3:67282426-67282448 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
956256579 3:67289841-67289863 GCAGACATTGCGACTGAATTAGG + Intergenic
956279832 3:67544432-67544454 GGAGAGAAAGAGAGTGAAGTGGG - Intronic
956408893 3:68958055-68958077 GCAGAGGGTGAGGGAGAAGTAGG - Intergenic
957439017 3:80218005-80218027 GCAGTGAGTGAGTGTGAAGGTGG + Intergenic
957442020 3:80260992-80261014 AGAGAGAGTGAGAGAGCATTTGG - Intergenic
957772732 3:84715381-84715403 GAAGAGAGAGAGAGTGAAGGGGG - Intergenic
957953030 3:87149251-87149273 GGAGAGAGAGAGAGCAAATTGGG + Intergenic
958253678 3:91299935-91299957 GAAGAGAGTGAGAATGTCTTTGG - Intergenic
958574981 3:95937136-95937158 GCTGTGAGTGAGAGTAAAATGGG + Intergenic
958584039 3:96062510-96062532 GGAGAGAGTGAGAGTGTAATGGG - Intergenic
959582686 3:107998107-107998129 GCAGTGAGTGATGGTGCATTAGG + Intergenic
959872497 3:111344133-111344155 AGAGAGAGAGAGAGAGAATTAGG - Intronic
961371286 3:126433515-126433537 GCTGAGAGGGTGAGAGAATTGGG + Intronic
962188129 3:133281724-133281746 CCAGAGAGGGAAAGTGACTTGGG - Intronic
964195410 3:154058791-154058813 ACAGAGAGTGAGAAGGAATAAGG - Intergenic
964341982 3:155717505-155717527 GCAGAGTGCAAGAGTGAATGAGG - Intronic
965093027 3:164185486-164185508 CAAGAGAGAGAGAGAGAATTTGG - Intergenic
965140790 3:164831771-164831793 AAAGAGAGTGAGAGTGAAAAGGG - Intergenic
967247052 3:187498703-187498725 GCAGAGAGAGAGAGTAACTGAGG - Intergenic
968111913 3:196055434-196055456 GCAGATAATGAGATAGAATTGGG - Intronic
968244177 3:197125227-197125249 TTAGAGTGGGAGAGTGAATTAGG + Intronic
969519635 4:7668461-7668483 GTAGAGAGTGAGAGTGGAGTGGG + Intronic
969622883 4:8287548-8287570 GGAGAGAGAGAGAGTGAAGTGGG + Intronic
969705305 4:8788469-8788491 TCAGAGAGGCAGAGTGACTTCGG + Intergenic
970472303 4:16391185-16391207 GCAGTGAGTGTGATTGTATTTGG + Intergenic
970968942 4:21959142-21959164 GGAGAGAGAGAGAGTGAAACAGG - Intergenic
972440361 4:39083130-39083152 GAAGAGATTGAGAGTGCTTTAGG + Intronic
972532083 4:39970484-39970506 GAAGAGAATGAGAGTGAGTTTGG - Intronic
975202876 4:71611654-71611676 GCACAGAGAGAGAGGGAACTGGG - Intergenic
975417535 4:74122355-74122377 GGAGAGAGAGAGAGTGAATGGGG + Intronic
975855789 4:78622758-78622780 GCAGAGGGTGAGAGTGGGTGAGG + Intergenic
976469934 4:85416990-85417012 GTACAGGGTGAGAGTGAAGTTGG - Intergenic
976544605 4:86319965-86319987 GCAGAGACTGAGAAGGACTTGGG - Intronic
977330473 4:95630823-95630845 GAAGAGAATGAGTGTGCATTTGG + Intergenic
977423417 4:96833217-96833239 GCAGAGAGTGAGAGTGAAGAAGG + Intergenic
977829474 4:101573307-101573329 ACAGAGAGAGAGAGAGAAATTGG + Intronic
977981638 4:103329844-103329866 GCAGAGACTGAAAATGAATTAGG + Intergenic
978374706 4:108062486-108062508 GCAGAGAGCAAGAGTGACTGGGG + Intronic
978651152 4:111006795-111006817 AGAGAGAGTGAGAATGAAGTAGG - Intergenic
978777846 4:112520837-112520859 GCTGGGAATGAGTGTGAATTCGG + Intergenic
978897845 4:113911162-113911184 GCAAAAAGTGAGAGAGAATTTGG + Intronic
979866076 4:125754984-125755006 ACAGAGAGAGACACTGAATTAGG + Intergenic
980277745 4:130677013-130677035 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
980318719 4:131239910-131239932 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
980823055 4:138041089-138041111 TCAGAGAATGACAGTGAATTAGG - Intergenic
981136053 4:141212886-141212908 GGAGAGAGAGAGAGTGAAGGAGG + Intergenic
981321515 4:143396937-143396959 GCAGAGAGTGAGTGGGGGTTAGG + Intronic
981680499 4:147392056-147392078 GCAGAGAGAGTGAGTGAAGGGGG - Intergenic
981891746 4:149746437-149746459 GCAGAGAAAGAGAGGAAATTGGG - Intergenic
982401763 4:154976097-154976119 GAAGAAAGAGAGAGAGAATTAGG + Intergenic
984626839 4:182017002-182017024 GCAAACAGTGAGGGTGTATTTGG - Intergenic
985233802 4:187850796-187850818 CCAGAGAATGAGAATGAATAGGG + Intergenic
985356632 4:189126766-189126788 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
985910796 5:2879419-2879441 GCACACACTGAGAATGAATTTGG + Intergenic
986388299 5:7261116-7261138 GCAGAGAGTTTGAGGGATTTGGG + Intergenic
986575259 5:9205757-9205779 TCAGGGAGTGAGACTGCATTTGG + Intronic
988150627 5:27374040-27374062 GGTGAGAGTGAGAGTGACGTTGG - Intergenic
988393632 5:30668758-30668780 GCAGAGAGTGAGGGAGAAAGCGG + Intergenic
988410987 5:30885400-30885422 GGAAAGAGAGAGAGAGAATTAGG + Intergenic
989279759 5:39627321-39627343 AAAGAGAGAGAGAGTGAGTTTGG + Intergenic
989669069 5:43892577-43892599 CCATAGAGTGAGTGTGAGTTTGG - Intergenic
991411993 5:66354919-66354941 GCAAAGAGTGATTGTGAATCAGG + Intergenic
991474909 5:67009209-67009231 TCAGTGAGTAAGAGAGAATTTGG + Intronic
995157106 5:108928799-108928821 GAAGAGGGTGAGAGAGAATGAGG + Intronic
995592866 5:113717707-113717729 GCAGAGAGTGCCTGGGAATTTGG + Intergenic
995940103 5:117571253-117571275 GCAGACAGTGAAAGAGAGTTTGG - Intergenic
996550472 5:124725071-124725093 GAGGAGAGGGAGAGTGTATTTGG - Intronic
998925146 5:147114922-147114944 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
999076005 5:148796181-148796203 GCAGAAATTGAGAATGAATAGGG + Intergenic
999082929 5:148861258-148861280 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
999740502 5:154546464-154546486 ACAGAGAGAGAGAGTGAGTAAGG + Intergenic
1000103665 5:158038416-158038438 GGAGAGAGAGGGAGTGAATGGGG - Intergenic
1000209682 5:159098000-159098022 GGTGGTAGTGAGAGTGAATTGGG - Intronic
1000262519 5:159601415-159601437 GCAGAAAGTGAAAGTGGAATGGG + Intergenic
1001083817 5:168686012-168686034 GCAGAGAGGTAGAGTGAGATGGG + Intronic
1001684681 5:173584601-173584623 GCAGGGAGTGACAAGGAATTTGG - Intergenic
1001841010 5:174876728-174876750 GCAGTGAGTGAGAGTTAAGAGGG + Intergenic
1002072713 5:176689833-176689855 CCAGAGAGTGAGAGTGCAGGAGG - Intergenic
1002108449 5:176891973-176891995 TCAGAGTCTGAGAGTGGATTAGG - Intronic
1002890099 6:1324739-1324761 GAAGACAGTGTGAGTGAATGTGG - Intergenic
1003125889 6:3355698-3355720 CCAGAAATTGAGAGTAAATTTGG - Intronic
1004815705 6:19309864-19309886 GGAGAGAGAGAGAGTGAAAGAGG - Intergenic
1004839338 6:19564863-19564885 GCAGAGAGAGACACTAAATTTGG - Intergenic
1005815616 6:29549878-29549900 GGAGAGAGTGAGAGGGGATCAGG + Intergenic
1006073679 6:31515766-31515788 GCAGAGAGTGATGGGGATTTGGG + Intergenic
1007081573 6:39108848-39108870 GTAGACTGTGATAGTGAATTAGG - Intronic
1007868176 6:44999192-44999214 AAAGAGAGTGAGAGTGAAGGTGG + Intronic
1008558511 6:52699807-52699829 GTAGAGTGTGAGTGTGAATATGG + Intergenic
1009359275 6:62793181-62793203 GCAGAGACTGAGGAAGAATTGGG - Intergenic
1009414126 6:63396748-63396770 GAAGAGGGTGAGTGTGAAGTGGG + Intergenic
1010595215 6:77754783-77754805 GCGGAGAGAGAGAGTGAAGGGGG + Intronic
1010731180 6:79393205-79393227 GGAGAGAGAGAGAGAGAAGTGGG - Intergenic
1011508578 6:88074913-88074935 GCATAACATGAGAGTGAATTAGG - Intergenic
1012496635 6:99840721-99840743 GAAGAGAGAGAGAGAGAAATGGG + Intergenic
1012907910 6:105089479-105089501 GATGAGAGTGAGAGTGGGTTTGG - Intergenic
1013431110 6:110055457-110055479 GCAGAGAGGAAGAGAGGATTAGG - Intergenic
1013851314 6:114519680-114519702 AGAGAGAGAGAGAGAGAATTAGG + Intergenic
1014147157 6:118011383-118011405 GGAGAGAGAGAGAGTTAAGTGGG + Intronic
1014340177 6:120195405-120195427 AGAGAGAGAGAGAGAGAATTTGG - Intergenic
1014526020 6:122502512-122502534 GAAGAGAGAGAGAGTGAAGGGGG + Intronic
1014966713 6:127762489-127762511 GCAGAGAGCCAGAGTGCATAAGG - Intronic
1015115671 6:129646785-129646807 TGAGAGAGTGAGAGTGAAAGAGG + Intronic
1015405803 6:132835733-132835755 GCAGACAGTCAGATTGAATTAGG - Intergenic
1015669994 6:135677820-135677842 GGAGAGAGAGAGAGTGCATAGGG - Intergenic
1015865846 6:137725502-137725524 GGAGACAGTGCGAGTGAATGGGG - Intergenic
1017165239 6:151401571-151401593 GCTGAAAGTGAGAGTAGATTTGG + Intergenic
1018149753 6:160926628-160926650 GGAGAGAGGGACAGTGAACTTGG + Intergenic
1018207919 6:161452849-161452871 AGAGAGAGAGAGAGAGAATTTGG - Intronic
1018622478 6:165743986-165744008 GCGGAGAGTGACTGTGACTTCGG + Intronic
1019493743 7:1326693-1326715 GGGGAGAGTGGGAGTGAACTAGG - Intergenic
1020438664 7:8193993-8194015 ACAGAGACTGAAAGTGAACTTGG - Intronic
1020601476 7:10279722-10279744 GGAGAGAGAGAGAGTGAAGGAGG + Intergenic
1021515017 7:21474940-21474962 GAGGAGAGTGAGATTGACTTTGG + Intronic
1021805372 7:24349551-24349573 GCAGAGGGTGAGAGTGAGCTGGG + Intergenic
1022109564 7:27220151-27220173 GCAGAGAGGGTCAGTGACTTGGG + Intergenic
1022460807 7:30604427-30604449 GCAGAGAGAGAGAGAGAGATCGG - Intronic
1022482867 7:30755397-30755419 GCAGAGAGAGAGAGGGAGTCGGG - Intronic
1023022979 7:36027642-36027664 GAAAAGAGTGAGAGTTATTTTGG - Intergenic
1023054820 7:36283165-36283187 CCAGACAGAGAGAGTGAACTGGG - Intronic
1023682010 7:42696827-42696849 GCAGAGAGTGAGAGGGTACCAGG + Intergenic
1024056882 7:45665491-45665513 AAAGAGAGAGAGACTGAATTGGG - Intronic
1025132473 7:56383511-56383533 ACAGAGAGAGGGAGAGAATTAGG - Intergenic
1026275965 7:68876647-68876669 GTAGAGAGTGAGAATCAAATGGG + Intergenic
1026349759 7:69505465-69505487 GTAGAGAGAGGGAGTAAATTTGG + Intergenic
1026581827 7:71624968-71624990 TAAGAGAGTGAAAGTGAATAAGG + Intronic
1026592835 7:71711496-71711518 GGAGAGAGAGAGAGTGCAATAGG - Intronic
1027186123 7:75971830-75971852 GCAGGGAGGGGGTGTGAATTAGG + Intronic
1027574376 7:79913845-79913867 GAAGAGAGAGAGAGAGAAATGGG + Intergenic
1028356257 7:89913722-89913744 GCAGAGAGTGAGAATGAGGGAGG + Intergenic
1028553315 7:92095735-92095757 GCACAGAGTTAGTGAGAATTAGG - Intronic
1030501940 7:110370215-110370237 ACAGAGAGTGAGAGTGGCTGAGG - Intergenic
1032050442 7:128646173-128646195 ACAGAGAGAGGGAGAGAATTAGG + Intergenic
1032061727 7:128730422-128730444 GCAGAGAGTGAAAAGGAAGTAGG + Intronic
1032330504 7:130974906-130974928 ACAGAGTGTAAGAGTGAATGAGG + Intergenic
1032531686 7:132626108-132626130 GAAGGGAAGGAGAGTGAATTGGG - Intronic
1033247399 7:139729368-139729390 AGAGAGAGAGAGAGAGAATTGGG + Intronic
1033604366 7:142915062-142915084 GCAGAGAGTGAGAGACAAGCTGG + Intronic
1034148467 7:148893422-148893444 GAAGAGAGAGAGAGTGAGGTAGG + Intergenic
1034853603 7:154519343-154519365 GCAGAATGTGAGTCTGAATTTGG - Intronic
1035071903 7:156151174-156151196 GCAGAGAGTGACAGGTGATTTGG - Intergenic
1035597319 8:868849-868871 GCCCAGAGTGAGGGTGAAGTGGG + Intergenic
1038306195 8:26404973-26404995 GCACAGAGTGGTAGTGAATGAGG + Intronic
1038581340 8:28751708-28751730 GCAAAGAGTGAGAAAGAATAGGG + Exonic
1039147419 8:34464419-34464441 GGAGAGAGTGAGAAGGTATTAGG + Intergenic
1040640197 8:49324379-49324401 GGAGAGAGTGAGAGTGAAGAGGG - Intergenic
1040687034 8:49886298-49886320 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
1040755621 8:50770878-50770900 GCAGAAAGTGGAAGTGAAGTGGG - Intronic
1042299618 8:67263072-67263094 GAAGGGAGTGAGAGAGAATCTGG - Intronic
1042325986 8:67528366-67528388 GCAGAGAGAGAGAATGGACTGGG + Intronic
1042949792 8:74189182-74189204 GCAGGGAGGGAGAGGGAAGTGGG - Intergenic
1042997863 8:74720846-74720868 GGAGAGAGAGAGAGTGAAGAGGG + Intronic
1043306054 8:78797476-78797498 GCAGAGAGAGAGAGAGCATATGG + Intronic
1044057191 8:87585849-87585871 GCAAAGAGAGAGAGAGACTTTGG + Intronic
1044327044 8:90870062-90870084 GAAGAGAGAGAGAGTGAAGAGGG - Intronic
1044492425 8:92835279-92835301 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
1044584604 8:93857903-93857925 GAAGAGAGTGAGAGCGAACTGGG + Intronic
1044622902 8:94208032-94208054 TCAGAGAATGAGATTCAATTTGG - Intronic
1045357196 8:101399702-101399724 ACAGAGAGAGAGAGAGATTTGGG - Intergenic
1046114628 8:109769880-109769902 GCAGAGAGAGAGAGAGGATTCGG - Intergenic
1046131790 8:109975116-109975138 GACTAGAATGAGAGTGAATTGGG - Exonic
1046648436 8:116810793-116810815 AAAGTGAGTGAGAGTGTATTTGG + Intronic
1046688799 8:117258855-117258877 GCAGAGAGAGAGAGTGAGTGTGG - Intergenic
1047607995 8:126493646-126493668 GGAGAGAGTGAGTGTGTGTTGGG + Intergenic
1047777317 8:128083713-128083735 CCAGAGAGTGAGAGTGAGAAGGG + Intergenic
1047934318 8:129761910-129761932 GTAGAGTGTGAGAGTGAGTGTGG + Intronic
1048069438 8:131006012-131006034 AGAGAGAGAGAGAGAGAATTTGG - Intronic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049489819 8:142889931-142889953 GGAGAGAGAGAGAGTGAAGGGGG + Intronic
1049654496 8:143791767-143791789 GCAGAGAGTGAGAGGAAAGGGGG + Intronic
1050052915 9:1622111-1622133 GGAGAGAGAGAGAGTGAAGGAGG + Intergenic
1050056752 9:1663444-1663466 GAAGAAAGTGAGATTAAATTAGG + Intergenic
1050296597 9:4211372-4211394 GCACTGAGTGTGAATGAATTTGG - Intronic
1050405996 9:5309261-5309283 GCAGAGAGTGAGAAGGGATGTGG - Intergenic
1050418122 9:5435469-5435491 GGAGAGAATGAGAGTGAAGCTGG - Intronic
1050538202 9:6648041-6648063 AAAGAGAGAGAGAGAGAATTGGG + Intergenic
1050602675 9:7268500-7268522 GAAGACAGTGAGAATGGATTTGG + Intergenic
1050676251 9:8057468-8057490 GCAGACAGTGAGATGCAATTTGG - Intergenic
1050895987 9:10886430-10886452 GCAGAGGCTGAGAAAGAATTGGG - Intergenic
1051226475 9:14904711-14904733 TCAGAGAGGGAGTGTGGATTAGG + Intronic
1051256289 9:15217097-15217119 GCAGAGAATGAGAGAAAATGAGG + Intronic
1053671954 9:40375275-40375297 GAAGAGAGAGAGAGTGAAGGGGG - Intergenic
1054352414 9:64029206-64029228 GCAGAGAGAGGGAGAGAAGTAGG + Intergenic
1054383067 9:64515323-64515345 GAAGAGAGAGAGAGTGAAGGGGG - Intergenic
1054512669 9:66001035-66001057 GAAGAGAGAGAGAGTGAAGGGGG + Intergenic
1055352088 9:75399952-75399974 GGAGAGAGAGAGAGTGAAGGGGG + Intergenic
1055644321 9:78348521-78348543 GCATAGAGTCAGAGGGAAATGGG - Intergenic
1055729161 9:79262951-79262973 AGAGAGAGAGAGAGTGAAGTGGG - Intergenic
1056362427 9:85872434-85872456 GCAGACACTGAGATGGAATTTGG + Intergenic
1056363616 9:85882357-85882379 GCAGAGGTTGAGAAAGAATTGGG - Intergenic
1056456172 9:86763189-86763211 GCAGAGAGTGACAGTGCAGCTGG + Intergenic
1056625637 9:88250888-88250910 GGAGAGAGAGAGAGTGAAGGGGG - Intergenic
1056733200 9:89183266-89183288 GGAGTGCGTGAGAGTGAATGAGG - Intergenic
1056798759 9:89676833-89676855 GCAGAGACAGACAGTGCATTTGG - Intergenic
1056905713 9:90645896-90645918 GCAGAGGGTGAGAGTGGCCTGGG - Intergenic
1057864557 9:98668671-98668693 GCAGAGAAGGAGGGAGAATTGGG - Intronic
1057911499 9:99023443-99023465 GCTGAGAGTGAGTGTGAAGGAGG + Exonic
1059723939 9:116987448-116987470 GGAGAGAGAGAGAGTGAAGGGGG - Intronic
1060297111 9:122350341-122350363 GCAGGGAGTGAGAGGGTCTTTGG + Intergenic
1060571577 9:124645343-124645365 GCAGATTGTTAGAGTGAATCAGG + Intronic
1203362509 Un_KI270442v1:230152-230174 GCAGAGAGAGAGAGAGAAATAGG + Intergenic
1185954810 X:4478021-4478043 ACAGAGAGAGAGAGAGAATGAGG + Intergenic
1185998188 X:4977276-4977298 ACAGAGAGAGAGTTTGAATTAGG + Intergenic
1186259608 X:7762796-7762818 GCAGAGAATGAGGGGAAATTGGG + Intergenic
1186268193 X:7854751-7854773 GAGGAGAGTGAGAGGGAATGAGG - Intergenic
1186723561 X:12332228-12332250 AGAGAGAGAGAGAGAGAATTTGG + Intronic
1187209246 X:17212553-17212575 GAAGAGAGAGAGAGTGACATAGG - Intergenic
1187251266 X:17600301-17600323 AGAGAGAGAGAGAGTGAGTTGGG + Intronic
1187866964 X:23731713-23731735 GCAGAGAGAGAGAGAGAACTGGG - Intronic
1189891152 X:45603829-45603851 AGAGAGAGAGAGAGTGAGTTAGG - Intergenic
1190270820 X:48861962-48861984 ACAGAGAGAGAGAGAGAATGGGG - Intergenic
1190584699 X:51927490-51927512 GCAAAGAGAGAGAGAGCATTAGG - Intergenic
1190653860 X:52593986-52594008 CCATAGAATGACAGTGAATTGGG + Intergenic
1191057654 X:56259190-56259212 GGAGAGAGAGAGAGAGAATTAGG - Intronic
1192051113 X:67724724-67724746 GCAGAGAGTGAGAGAGAAAAGGG - Exonic
1193278402 X:79619252-79619274 GCAGAGAGTGAGAGGGAGACTGG + Intergenic
1194035432 X:88864615-88864637 GAAGGGAGGGAGAGTGAATGGGG - Intergenic
1194742115 X:97586117-97586139 GAAAAGAGTGAGAGAGATTTGGG - Intronic
1194972233 X:100356749-100356771 AGAGAGAGAGAGAATGAATTAGG - Intronic
1195118307 X:101722540-101722562 GCAAAGTGTTAGAGTGAATGAGG + Intergenic
1197301882 X:124790520-124790542 GGAGAAAATGAGAGTGTATTTGG - Intronic
1197559363 X:127999115-127999137 TCAGAGAGAGAGAATGATTTTGG + Intergenic
1197833319 X:130668598-130668620 CCAGAGAGGGAGAGTACATTTGG + Intronic
1199924558 X:152449270-152449292 GCAGTGACAGAGAGTGCATTAGG - Intronic
1200881721 Y:8220171-8220193 ACTGAGACTGAGAGTGAATATGG + Intergenic
1201075727 Y:10186052-10186074 GCAGAGAGAGAGAGAGAAATAGG - Intergenic
1201154303 Y:11115763-11115785 GCAGAGAGAGGGAGAGAAGTAGG + Intergenic
1201456352 Y:14171389-14171411 GCAGAGAATGAGGGGAAATTGGG - Intergenic
1202130688 Y:21605951-21605973 GCAGAGAGCAAAAGGGAATTTGG - Intergenic