ID: 1087648248

View in Genome Browser
Species Human (GRCh38)
Location 11:100833001-100833023
Sequence GTTTTGTATCCTGTAAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087648243_1087648248 24 Left 1087648243 11:100832954-100832976 CCAGAAGGGAACTATGCTGCTTG 0: 1
1: 0
2: 1
3: 7
4: 91
Right 1087648248 11:100833001-100833023 GTTTTGTATCCTGTAAATACAGG 0: 1
1: 0
2: 0
3: 14
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087648248 Original CRISPR GTTTTGTATCCTGTAAATAC AGG Intronic
903308881 1:22436650-22436672 GTTTTGTTTCTTTTAATTACTGG - Intergenic
908204311 1:61829564-61829586 GCTTTCCATTCTGTAAATACAGG + Intronic
909827704 1:80146325-80146347 GTTTTGTATCCTGACCATGCTGG + Intergenic
913553796 1:119943214-119943236 GTTATATATCCTGTAAATTAAGG + Intronic
915031290 1:152882328-152882350 CTTTTGTGTCCTGTAGATAAAGG - Intronic
916355470 1:163901336-163901358 TTTTTGTATCATGGTAATACCGG - Intergenic
916998381 1:170327093-170327115 GTTTTATATTCTGTAATTTCTGG - Intergenic
917753623 1:178077366-178077388 GTTTTGTCTACCTTAAATACAGG - Intergenic
919654544 1:200184711-200184733 GTTTTGTTTTCTGTAGAGACAGG + Intergenic
920655513 1:207871450-207871472 TTTTTGTATCTTGTAGAGACAGG + Intergenic
921036950 1:211388906-211388928 GTTCTGTATCCTGTTAATGGTGG + Intergenic
921774583 1:219082203-219082225 GTGATGTATCCTGCAAGTACAGG + Intergenic
1063106256 10:2995525-2995547 GTGATTTATCCTGTAAATTCAGG + Intergenic
1067519579 10:46987076-46987098 TTTTTGTTACCTGTTAATACTGG + Intronic
1067642668 10:48064763-48064785 TTTTTGTTACCTGTTAATACTGG - Intergenic
1070592065 10:77808441-77808463 GTTTTGTTTTCTGTAAAGACAGG + Intronic
1071688551 10:87790108-87790130 GTATTTTAACATGTAAATACAGG + Intronic
1072255693 10:93618367-93618389 GTTTTGTAATCTGAAAATAGGGG - Intronic
1072995888 10:100243860-100243882 TTTTTATATCCTGAAAAGACTGG + Intronic
1073642025 10:105262522-105262544 GTTCTGTGTCCTCTAAACACTGG + Intronic
1075002753 10:118810122-118810144 GATTTTTCACCTGTAAATACGGG + Intergenic
1077571599 11:3343854-3343876 GTTCTGAATCCTGTAAAGTCAGG - Intronic
1078801883 11:14653825-14653847 ATTTTGTATCTTGTAGAGACAGG - Intronic
1079514314 11:21248859-21248881 GTTTTTTATCCTGGTAATATTGG + Intronic
1081296297 11:41393772-41393794 ATTTTGTATTCAGGAAATACTGG + Intronic
1083700591 11:64475244-64475266 GTTTAGAATGCTGTAGATACGGG + Intergenic
1085287771 11:75375311-75375333 TTTTTGTATTTTGTAAAGACGGG + Intergenic
1085613348 11:77973334-77973356 GTTATGTCACCTGTGAATACGGG + Intronic
1085799853 11:79579399-79579421 GGTTTGTATTTTGTAAATAGAGG - Intergenic
1085956971 11:81410403-81410425 GTTTTGTTTCCCTTAAATATTGG - Intergenic
1086179639 11:83935115-83935137 GTTCTATATTCTGCAAATACAGG - Intronic
1086222849 11:84470828-84470850 GTATTTTATTCTGTAAGTACTGG + Intronic
1087315784 11:96600545-96600567 GTTTTGTTTCATTTAAAGACAGG - Intergenic
1087369716 11:97267767-97267789 GTTTTGTATCGGGGTAATACTGG + Intergenic
1087648248 11:100833001-100833023 GTTTTGTATCCTGTAAATACAGG + Intronic
1087786079 11:102355945-102355967 GTTTTGTATCCTACAACTTCTGG + Intronic
1089026190 11:115272700-115272722 GTTTTATTTCCTGTAAAGAAAGG + Intronic
1089697071 11:120222384-120222406 TTTTTGTATTTTGTAAAGACTGG - Intronic
1090864307 11:130683842-130683864 ATTTTGTATCCTGAAATTGCTGG + Intronic
1092498021 12:9016972-9016994 GTTTTGTATCAGGGTAATACTGG - Intergenic
1093748408 12:22770047-22770069 ATTTTATATTCTGTAAAAACTGG + Intergenic
1093956676 12:25228444-25228466 GTGTTGTAGCATGTATATACAGG - Intronic
1094177648 12:27557923-27557945 GTTTTGTTTCCTGATAATCCTGG + Intronic
1094219664 12:27978353-27978375 GGTTTTTGTCCTGTAAACACAGG + Intergenic
1094390534 12:29944776-29944798 GTTTTGAATTCTGTAATAACTGG - Intergenic
1095860558 12:46912483-46912505 TTTTTGTATGCAGTTAATACTGG - Intergenic
1096445079 12:51682307-51682329 GTTTTGTATCAAGGTAATACTGG + Intronic
1097582668 12:61477606-61477628 GTTTTGTATCCTTCACATAAAGG + Intergenic
1097710589 12:62913265-62913287 GTCTTTTATCCTGTAACTTCTGG - Intronic
1098323555 12:69277110-69277132 ATCTTGTCTCATGTAAATACAGG + Intergenic
1098529955 12:71530582-71530604 GTTATTTTTCCTGTAAATATTGG + Intronic
1099771184 12:87059294-87059316 TTTTGGTAACCTGAAAATACAGG + Intergenic
1100598875 12:96095203-96095225 GTTTGGTGTCCAGTAAATTCTGG - Intergenic
1104515851 12:129425994-129426016 GTTGTGGGTCCTGCAAATACTGG - Intronic
1105650356 13:22370789-22370811 GTCTTGTATCCAGTGAATCCTGG - Intergenic
1108747930 13:53414242-53414264 GTTTTCACTTCTGTAAATACTGG + Intergenic
1108785074 13:53890336-53890358 GATTTGACTCCTGAAAATACAGG - Intergenic
1109219447 13:59626493-59626515 GTTTTGTATTCTGAAAATGATGG + Intergenic
1109296252 13:60534449-60534471 GTCTTTAATCCTATAAATACTGG + Intronic
1109486834 13:63034845-63034867 GTTTTATATCCTAAAAATTCAGG + Intergenic
1109540875 13:63777303-63777325 TTTATGTTTCTTGTAAATACTGG + Intergenic
1109842545 13:67938318-67938340 GTTCTGTATTCTGTTAATATTGG + Intergenic
1110189097 13:72709525-72709547 GTTTTATATCCTATAAATAACGG - Exonic
1112167792 13:96938020-96938042 TTTTTGTATTTTGTAAAGACAGG - Intergenic
1113754453 13:112800866-112800888 CTTTTTTAGCCTGTAAATATGGG - Intronic
1116201833 14:41807302-41807324 GTTTTGTATCCATTGAATAGGGG + Intronic
1116269544 14:42743331-42743353 TTTTTGTATCAGGTTAATACTGG - Intergenic
1117887099 14:60376146-60376168 GTTTTGTATCCCATAAGTCCAGG + Intergenic
1118356819 14:65020899-65020921 TTTTTGTATTTTGTAAAGACAGG + Intronic
1120230940 14:81840338-81840360 GTTTTGAATTCTATAAATAAAGG - Intergenic
1121671352 14:95712768-95712790 TTTTTTTTTCCTGTAGATACAGG - Intronic
1124271045 15:28281001-28281023 GTTTTGTAACATGAAAATAATGG - Intronic
1125667484 15:41443204-41443226 GTTTTCTATCCTGAAAAAAATGG + Intronic
1125669423 15:41459654-41459676 GTCTTGAATCCTGTGAAGACAGG - Intronic
1126463795 15:48941783-48941805 GTTTTGTTTCATGGATATACCGG + Intronic
1127599639 15:60522596-60522618 GTTTTATTTCCTGTAGAGACAGG - Intronic
1129022432 15:72533733-72533755 GTTTAATTTTCTGTAAATACGGG - Intronic
1131390179 15:92041479-92041501 TTTTTGTATGCTGTGAATTCAGG + Intronic
1134472587 16:14540131-14540153 GATTTTTATGCTGTAAGTACAGG - Intronic
1136425355 16:30166477-30166499 GTTTTATATCCTGAAAAGAGAGG + Intergenic
1137003867 16:35255005-35255027 GGTGTGTATCCTCTATATACTGG - Intergenic
1140329870 16:74045224-74045246 TTTTTGGCTACTGTAAATACAGG - Intergenic
1140409375 16:74732831-74732853 GTTCTGTTTCCTGTACATCCAGG - Intronic
1143299212 17:5897158-5897180 GTTTTGTAATCTGTAAAGGCTGG + Intronic
1143662816 17:8337436-8337458 GTTTTGTATTTTGTAGAGACAGG - Intergenic
1145355982 17:22152321-22152343 GTTTTATATCCTAAAAATTCAGG - Intergenic
1145408231 17:22629735-22629757 ATTTTGTTTCTTGAAAATACTGG + Intergenic
1145925125 17:28641189-28641211 GTTTCATATCCTGCAAATATTGG + Intronic
1146517586 17:33501442-33501464 GTTTTTACTCCTGTAAACACTGG + Intronic
1148261934 17:46192362-46192384 TTTTTGTTGCCTGTAAATTCAGG - Intronic
1152971499 18:166226-166248 GTATTTGATGCTGTAAATACAGG + Intronic
1153063326 18:1016764-1016786 GTTTTGTATACTACAAAGACAGG - Intergenic
1155443784 18:25889095-25889117 GTTTGGTATCCAGGTAATACTGG - Intergenic
1156708171 18:39909229-39909251 GTTTTGTATTCTGAAAATCCTGG + Intergenic
1156751738 18:40466200-40466222 GTTTGCTATCTTGTAAAAACTGG + Intergenic
1158209146 18:55026637-55026659 GTTTTGTACTCTGTAATAACAGG - Intergenic
1162974495 19:14200786-14200808 ATTTTGTATTCTGTAAAGAAGGG + Intronic
1168338022 19:55607426-55607448 TTTTTTTTTCCTGTAAAGACAGG - Intronic
925475412 2:4208221-4208243 ATCTTGTAGTCTGTAAATACAGG + Intergenic
926169094 2:10539809-10539831 TGTTTGTATCCTGTATAAACTGG + Intergenic
929451148 2:42038362-42038384 GTTTTGTAAACTATAAATCCGGG - Intergenic
930249736 2:49021959-49021981 ATTCTTTATCCTGTAAGTACAGG + Intronic
931660515 2:64557712-64557734 GTTTTCCATCCTGTGAACACTGG + Intronic
932707271 2:74036169-74036191 GTTTTGTCACCTGTAAATTGGGG - Intronic
934862045 2:97772415-97772437 TTTCTGTATCCTGTAAAAAATGG + Exonic
934991676 2:98925976-98925998 TTTTTGTAGCATATAAATACTGG - Intronic
935725118 2:106017243-106017265 GTTTTGTATTCTGGAGCTACAGG + Intergenic
935825418 2:106943309-106943331 ATTTTGCATCCTCTAAATACAGG + Intergenic
937586968 2:123564551-123564573 GTTTTGCATCCTGGAAAAATAGG - Intergenic
938202753 2:129389140-129389162 GTTTTGGTGCCTGTAAATTCTGG - Intergenic
939133696 2:138269082-138269104 ATTTTGTATCATGCTAATACTGG + Intergenic
939526107 2:143296357-143296379 GTTTTCTTTCTTGTAACTACAGG - Intronic
940560626 2:155291342-155291364 GTTTTGTTCCTTGTAAATTCTGG + Intergenic
941248140 2:163126140-163126162 GATTTGTGTCCTTTAGATACCGG + Intergenic
942546704 2:177072454-177072476 GTTTTGTGTGCTGTGAATGCAGG - Intergenic
943996154 2:194768405-194768427 ATTTTGTATCCTGTAAGTTTTGG - Intergenic
944787190 2:203084972-203084994 GTTACATACCCTGTAAATACAGG + Intronic
944893403 2:204140294-204140316 CTTTTGTATCCTGTTAGGACTGG - Intergenic
947304460 2:228728404-228728426 GTGTTCTATCCTGTAAAGACAGG + Intergenic
948555387 2:238806557-238806579 GTGTTGAAACCTGTAAAAACTGG - Intergenic
1168883818 20:1229303-1229325 GTTTTTTCTTCTGTAAATAGAGG + Intronic
1172823872 20:37763367-37763389 ATTTGGGAGCCTGTAAATACAGG - Intronic
1174008113 20:47426741-47426763 GTTTTGTTTTCTGTAGAAACGGG - Intergenic
1174191939 20:48747172-48747194 CCTTTGTGTGCTGTAAATACTGG + Intronic
1174992383 20:55525296-55525318 TTTTTGTATCATGGCAATACTGG + Intergenic
1176978798 21:15355062-15355084 TTTTTGTACTCTGTAGATACAGG - Intergenic
1177275000 21:18899054-18899076 ATTTTGTTTCCTCTAAAGACTGG + Intergenic
1177566903 21:22835524-22835546 GTTTTGTATCCTGTAACTCTTGG - Intergenic
949648847 3:6131280-6131302 GTTTTGTTTTCAGTAAAGACAGG + Intergenic
951495795 3:23324660-23324682 TTTTTGTATCCTGTTATCACAGG + Intronic
952235556 3:31475746-31475768 TATTAGTATCCTGAAAATACAGG + Intergenic
952811350 3:37406635-37406657 GTTTGGTATCAGGTTAATACTGG + Intronic
954775567 3:53014464-53014486 GTTTTGTTTTTTTTAAATACAGG - Intronic
955505731 3:59631437-59631459 GTTTGGAATCATGTAAATATAGG + Intergenic
956040066 3:65136387-65136409 GTTTTGTTTCCTTCAAAGACAGG - Intergenic
956503790 3:69915553-69915575 TTTATTAATCCTGTAAATACAGG - Intronic
956852396 3:73241608-73241630 GTTTTGTATCAGGGTAATACTGG + Intergenic
957729199 3:84110626-84110648 CTTTTGTAGCCTGTGAATTCTGG + Intergenic
957970138 3:87373466-87373488 ATTTTTTTTCCTGTAAAGACGGG - Intergenic
958078639 3:88716403-88716425 GTTTTGTATCATGGTAATACTGG - Intergenic
958739663 3:98053679-98053701 GTTTTTCATACTGTAAATAAAGG - Intergenic
959437083 3:106329080-106329102 GCTTTGTATTCTTTGAATACTGG - Intergenic
960271093 3:115675587-115675609 GTTTTGTATTTTGTAGAGACGGG - Intronic
960757370 3:121030660-121030682 GTTTTTTATACTTTAAGTACTGG - Intronic
960814052 3:121655306-121655328 GTTTTGTTTCCTGTTAATATAGG - Intronic
961982826 3:131099300-131099322 GTTTTCTATTCTGTAGCTACTGG + Intronic
965531702 3:169776871-169776893 TTTTTGTATTTTGTAGATACGGG + Intronic
966163662 3:176993078-176993100 ATTTTGTTTCCACTAAATACAGG + Intergenic
966177411 3:177153463-177153485 ATTTTATATGCTGTAAACACTGG - Intronic
967175578 3:186860896-186860918 GTTAGCAATCCTGTAAATACCGG + Intergenic
967725191 3:192855738-192855760 ATTTTCTATCCTGTAAATGGAGG - Intronic
968536439 4:1133484-1133506 TTTTTCTATCCTGTGAATACGGG + Intergenic
970132209 4:12884589-12884611 TTTTTGTAACCTGAAAATAGGGG - Intergenic
970170405 4:13283679-13283701 GTTTTCTAACCTGTAAATCAGGG - Intergenic
970410411 4:15801446-15801468 GTTTTGTATCAGGTTAATTCTGG - Intronic
972004764 4:34086697-34086719 TTTATGTATTCTGTAAGTACAGG - Intergenic
972440108 4:39079790-39079812 GATGTGTGTCCAGTAAATACTGG - Intronic
973533272 4:51854088-51854110 GTTTTCTATACTGTAAATCTAGG - Intronic
973859867 4:55052509-55052531 GTTTTCTTTTCTGTAAAAACAGG + Intergenic
974841472 4:67304218-67304240 GTTTTGTATCCTAGAAACAGTGG - Intergenic
975025106 4:69538827-69538849 ATTTTTTATCATATAAATACTGG + Intergenic
975093472 4:70430129-70430151 CCTTTGTATCCCATAAATACTGG + Intergenic
975601457 4:76104336-76104358 GTTTTGTTACCTGGAGATACAGG - Intronic
977498981 4:97814710-97814732 GTTTTATATCCTGTCCATGCTGG - Intronic
980132719 4:128831637-128831659 CTTTTGTTTGCTGTAAATCCTGG + Intronic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982561860 4:156937785-156937807 GTATTGTATTGTGTAAACACAGG - Intronic
984413239 4:179424237-179424259 GTTTTCTACCATGTAAATAGTGG - Intergenic
987334860 5:16889686-16889708 GTTTTGTGTGCTTTAAAAACAGG - Intronic
987826889 5:23042731-23042753 GTTTTGTATTCTTTAAATTTAGG + Intergenic
987874293 5:23659558-23659580 GTTTTGTATCAGGGCAATACTGG - Intergenic
988371462 5:30373711-30373733 GTTTTGTATACTTTAAAAAAAGG - Intergenic
990147147 5:52775211-52775233 GTTTGGTATCATGTAAACATGGG - Intergenic
990216643 5:53540376-53540398 GTTTAATCTCCTGTAAATAGAGG - Intergenic
990613555 5:57484144-57484166 GTTTTTTGTCCAGTAAATAGGGG - Intergenic
991537293 5:67684245-67684267 GTTTTGTATCAGGGTAATACTGG + Intergenic
993090279 5:83417339-83417361 GTTTTGTAACTTGTACATAATGG - Intergenic
994016360 5:94971136-94971158 GTTTTGTATCCTTAAAATGAGGG + Intronic
994990153 5:106985836-106985858 GTTTTGTGTTCTGAAAATTCAGG - Intergenic
995142926 5:108753745-108753767 ATTGTGTGTTCTGTAAATACAGG + Intronic
995342879 5:111079459-111079481 ATTTGGTAATCTGTAAATACTGG - Intergenic
997657127 5:135563713-135563735 GTTTTATATCCTATAAAATCTGG - Intergenic
997953024 5:138257100-138257122 GTTTAGTCCCCTGTAAAAACTGG - Intronic
998085868 5:139322104-139322126 TTTTTGTATGCTAAAAATACAGG + Intronic
998538672 5:142958493-142958515 GTTTTATATTTTGTAAAGACGGG - Intronic
1000580276 5:163027526-163027548 GTTTAGAAATCTGTAAATACAGG + Intergenic
1001983218 5:176051092-176051114 GTGTTGTATGCTGAAGATACTGG + Intronic
1002234247 5:177792960-177792982 GTGTTGTATGCTGAAGATACTGG - Intronic
1003627097 6:7751472-7751494 GTATTGTATCCTAGAAATTCAGG - Intronic
1004089978 6:12491002-12491024 GTTTTGTTTCCTGTTATTGCAGG - Intergenic
1005163791 6:22895969-22895991 GTTTTGTATCATTTAAATTTAGG - Intergenic
1005615792 6:27571890-27571912 TTTTTGTATTTTGTAAAGACAGG - Intergenic
1006862368 6:37180998-37181020 TTTTTGTATTTTGTAGATACAGG - Intergenic
1009308267 6:62119446-62119468 GTTTTATCTCCTGTAGATAAAGG + Intronic
1009359905 6:62798243-62798265 GCTTTGTATACTTTAAATTCAGG + Intergenic
1009850802 6:69195634-69195656 TTTTTGTATCCTGTGAACAAGGG + Intronic
1011455609 6:87545253-87545275 TTTTTGTATTTTGTAAAGACAGG + Intronic
1011728392 6:90234143-90234165 GTTAAGTTTCCTGGAAATACAGG + Intronic
1013881521 6:114907824-114907846 CTTTTGTAACCTTTAAAGACAGG + Intergenic
1014760039 6:125346226-125346248 AGTTTGTTTCCTGTAAATAGAGG - Intergenic
1014777556 6:125528498-125528520 GTTCTGTACCCAGTAAATTCAGG - Intergenic
1014792920 6:125694797-125694819 TTTTGGTATCAAGTAAATACTGG - Intergenic
1014975590 6:127878069-127878091 CTTTTGTTTCCTATTAATACAGG + Intronic
1016100892 6:140098823-140098845 GTATTTTAACCTGTAGATACTGG + Intergenic
1017112373 6:150944624-150944646 GTATTGTATCCTGGAATTCCTGG + Intronic
1020221779 7:6244022-6244044 GGTTTAAAACCTGTAAATACAGG - Intronic
1024341315 7:48264655-48264677 AGTTTGTATCCTGTATATACAGG - Intronic
1025704620 7:63851693-63851715 GTTTTGTACCCCATAAATATAGG - Intergenic
1027435252 7:78157776-78157798 GTTTTGTATCCTTTTAATCTTGG + Intronic
1030465926 7:109903760-109903782 GTTTTGTATCAGGTTAACACTGG + Intergenic
1031319163 7:120300264-120300286 GTGTTGTGTCCAGAAAATACAGG + Intronic
1032107227 7:129043227-129043249 TTTTTTTTTCCTGTAAAGACTGG - Intronic
1032493577 7:132343745-132343767 GTTTTGTATTCTGTAGAGATGGG - Intronic
1033029552 7:137812376-137812398 GTTCTATATCCTATAAAGACGGG + Intronic
1033334609 7:140441739-140441761 GTCTTGTCTGCTGTAAAAACAGG + Intergenic
1033497911 7:141918069-141918091 CTTCTGTATCCTCTAAACACAGG - Intronic
1037202318 8:16271630-16271652 GTTTTATATGTTGTAAATATTGG - Intronic
1043578639 8:81686994-81687016 TTTTTGTATCTTGTAGAGACGGG + Intergenic
1045991825 8:108316741-108316763 GTTTTGTAGCCTTTAATTTCTGG - Intronic
1050135208 9:2455906-2455928 TTTTGGTATCCTGGTAATACTGG - Intergenic
1050303946 9:4287284-4287306 GTCATGTATCATGTACATACTGG - Intronic
1053531685 9:38888494-38888516 GTTGTGTATACTGGAAATAAAGG + Intergenic
1054203909 9:62112922-62112944 GTTGTGTATACTGGAAATAAAGG + Intergenic
1058035175 9:100244378-100244400 GTTTTGTTTTCTGTAAACAGGGG - Intronic
1186803179 X:13113867-13113889 GTTTTGTTTTTAGTAAATACAGG - Intergenic
1188093598 X:25993971-25993993 TTTTTGAATGCTTTAAATACTGG + Intergenic
1189687298 X:43578306-43578328 GTTTTGTATCAGGTAATAACTGG - Intergenic
1189894305 X:45638009-45638031 ATTTTGTATCCTGAAACTACTGG - Intergenic
1190177068 X:48159097-48159119 ATTTTATATTTTGTAAATACGGG + Intergenic
1190981676 X:55461981-55462003 GTTTTGTATTCTGTGATTGCAGG + Intergenic
1190981755 X:55462747-55462769 GTTTTGTAACCTGTAAAATGGGG - Intergenic
1190986943 X:55510433-55510455 GTTTTGTAACCTGTAAAATGGGG + Intergenic
1190987022 X:55511199-55511221 GTTTTGTATTCTGTGATTGCAGG - Intergenic
1193366102 X:80636395-80636417 TTTTTGTATTTTGTAAATACAGG - Intergenic
1193846305 X:86475531-86475553 ATTTTGTATCCTGCAACTACTGG + Intronic
1194628018 X:96248533-96248555 TTTTTGTATCTTTAAAATACAGG - Intergenic
1196052773 X:111322894-111322916 GTTATGAATCCTTTAAATAAGGG + Intronic
1196269169 X:113690786-113690808 GTTTTGTGTGATGTAAGTACAGG + Intergenic
1197257403 X:124278137-124278159 GTTTTGTATACTGGAAACATAGG + Intronic
1197388701 X:125833052-125833074 TTTTTGTATGACGTAAATACAGG - Intergenic
1199375754 X:147107131-147107153 GTTTTGTGTCCTGTAAACAAGGG - Intergenic
1201423578 Y:13825479-13825501 GCTTTGTATCCAATAAATAATGG + Intergenic