ID: 1087648793

View in Genome Browser
Species Human (GRCh38)
Location 11:100839788-100839810
Sequence CGAGACTGGTCCTCCTTTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 65}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087648793 Original CRISPR CGAGACTGGTCCTCCTTTAT CGG (reversed) Intronic
902538073 1:17133170-17133192 TCAGACTGGTCCTCCCTTTTTGG + Intergenic
904290278 1:29480795-29480817 TGAGACTGATCCACATTTATAGG - Intergenic
905708448 1:40080437-40080459 CGATACACATCCTCCTTTATGGG + Exonic
907440104 1:54473741-54473763 GAAGACTGGTCCTCCTCTTTTGG + Intergenic
918086893 1:181253066-181253088 TGATGCTGATCCTCCTTTATGGG + Intergenic
924078124 1:240362667-240362689 CAAGCCTGGTTCTCCTTTGTTGG + Intronic
1062978552 10:1702782-1702804 TCAGACTGGCCCTCCTTTAGAGG + Intronic
1063843762 10:10102319-10102341 TGAGACTGGTCTACCTTGATGGG - Intergenic
1072229646 10:93403511-93403533 AGTGACTGGTGCTCCTTTCTTGG + Intronic
1085594293 11:77793800-77793822 GAAGACCGGTCCTCCTCTATTGG - Intronic
1087648793 11:100839788-100839810 CGAGACTGGTCCTCCTTTATCGG - Intronic
1088620959 11:111683269-111683291 AAAGACTGGTCCTCCTCTATTGG - Intronic
1091841159 12:3621849-3621871 TGAGTCTGTTTCTCCTTTATCGG - Intronic
1092602773 12:10084344-10084366 CCAGACTGGTCCTCCTCTATCGG - Intronic
1092969925 12:13683700-13683722 GAAGACCGGTCCTCCTTTATTGG - Intronic
1094202269 12:27806210-27806232 CAAGACTGGTCCTCCTCTATTGG + Intergenic
1094836725 12:34325592-34325614 CAAGACTTGTCTTCCTTTCTGGG + Intergenic
1102358984 12:112267235-112267257 GAAGACCGGTCCTCCTCTATCGG - Intronic
1110660901 13:78058746-78058768 AGATGCTGATCCTCCTTTATGGG - Intergenic
1112070177 13:95841385-95841407 GAAGATTGGTCCTCCTCTATTGG + Intronic
1112416275 13:99205866-99205888 AAAGACCGGTCCTCCTCTATCGG - Intronic
1115762952 14:36593967-36593989 GAAGACAGGTCCTCCTCTATTGG + Intergenic
1116570056 14:46505108-46505130 CAACACTGGTCCTGCTTTTTTGG + Intergenic
1120916189 14:89712669-89712691 GAAGACTGGTCCTCCTCTGTCGG - Intergenic
1121783580 14:96638351-96638373 GAAGACCGGTCCTCCTCTATCGG + Intergenic
1122295464 14:100703331-100703353 CGAGACTGGTCCTGTTTGCTGGG + Intergenic
1123102424 14:105813945-105813967 CCTCACTGGTCCTCCTTTAAAGG + Intergenic
1131878968 15:96842226-96842248 GAAGACTGGTCTTCCTCTATTGG - Intergenic
1139496328 16:67321807-67321829 GAAGACTGGTCCTCCTTTATTGG + Intronic
1141209363 16:81962084-81962106 GAAGACCGGTCCTCCTCTATCGG - Exonic
1151228391 17:72663972-72663994 GAAGACCGGTCCTCCTCTATTGG + Intronic
1153467007 18:5398898-5398920 CGAGACTCGGCCTCCTTGATGGG + Intronic
1154005547 18:10524559-10524581 CTAGCCTGGGCTTCCTTTATAGG - Intergenic
1155566270 18:27138107-27138129 AGAGACAGGCCCTCCATTATGGG - Intronic
1155610915 18:27666640-27666662 TGAGGCTGGTCCTCCTTTGATGG - Intergenic
1155932114 18:31719051-31719073 AAAGACCGGTCCTCCTCTATTGG - Intergenic
1159128371 18:64251953-64251975 TGAGCCTGGTCCTCATTTCTGGG - Intergenic
1163941780 19:20501945-20501967 TGATGCTGATCCTCCTTTATGGG - Intergenic
930167504 2:48217733-48217755 GAAGACTGTTCCTCCTCTATTGG - Intergenic
934134933 2:88986254-88986276 CAAGACTGGTCATCCTCTGTTGG + Intergenic
938672074 2:133596249-133596271 AAAGACTGGTTCTCCTCTATCGG - Intergenic
945096148 2:206221472-206221494 CAAGACCAGTCCTTCTTTATTGG - Intergenic
1170019362 20:11818911-11818933 GAAGACTGGTCCTCCTCTGTCGG + Intergenic
1172495625 20:35381627-35381649 AAAGAATGGTCCTCCTCTATTGG + Intronic
1173305496 20:41844139-41844161 AGAGGCTGGTCCTCCATTCTGGG + Intergenic
1181441626 22:22938955-22938977 CAAGACTGGGCCTCTTTTTTGGG - Intergenic
1184138726 22:42565151-42565173 GAAGACCGGTCCTCCTCTATCGG + Intronic
951696212 3:25448203-25448225 CGAAACTTGTCCACCTTTATAGG - Intronic
957135201 3:76278834-76278856 CGCCACTAGTCCTCCTCTATAGG + Intronic
962881728 3:139584266-139584288 GAAGACCGGTCCTCCTCTATCGG + Intronic
964527338 3:157629684-157629706 AGAGTCTGGTCCTCTTTCATGGG + Intronic
967204022 3:187103018-187103040 CATGACTGGTCATCTTTTATTGG + Intergenic
967659895 3:192093280-192093302 AAAGACAGGTCCTCCTCTATTGG - Intergenic
979467889 4:121061298-121061320 AAAGACCGGTCCTCCTTCATCGG + Intronic
984237777 4:177181557-177181579 GAAGACTGGTCCTCCTCTACTGG - Intergenic
991444989 5:66689948-66689970 CTAGACTTGGCCTCCTCTATTGG + Intronic
999110503 5:149116300-149116322 CAAGACTGGTCCTTCTCTATTGG + Intergenic
1001187539 5:169589518-169589540 CTATACTGGTCCTCCCTTATGGG + Intronic
1005984753 6:30864407-30864429 GAAGACTGGTCCTCCTCTATTGG - Intergenic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1008591279 6:52995778-52995800 GAAGACCGGTCCTCCTCTATCGG - Intergenic
1010419412 6:75655119-75655141 CAAGATCGGTCCTCCTCTATTGG + Intronic
1013615369 6:111838071-111838093 AAAGACTGATCCTCCTTTGTGGG - Intronic
1015523387 6:134153057-134153079 AGAGACTGGTGGTCTTTTATGGG + Intergenic
1017850207 6:158298925-158298947 TGATGCTGATCCTCCTTTATGGG - Intronic
1019663314 7:2238111-2238133 GGACACTGGTCCCCATTTATTGG - Intronic
1026589920 7:71685567-71685589 AAAGACTGGTCTTCCTCTATTGG + Intronic
1029733802 7:102454531-102454553 CGAGTCTGGTCCTCCCTCACAGG - Exonic
1040089065 8:43377616-43377638 AGTGACTGTTTCTCCTTTATGGG - Intergenic
1041785754 8:61631832-61631854 GAAGACTGGTCCTCCTGTATCGG + Intronic
1046753231 8:117946635-117946657 CACGACTGGTCCTCGTGTATAGG - Intronic
1057023988 9:91722213-91722235 AGAGAATGGGCCTCCTTCATGGG - Intronic
1058451067 9:105096913-105096935 GAAGACTGGTCCTCCTCTACTGG - Intergenic
1058601984 9:106680134-106680156 GAAGACTGGCCCTCCTCTATTGG - Intergenic
1060320865 9:122559998-122560020 TGAGTCTGGTGCTCCTGTATTGG + Intergenic
1190296377 X:49030102-49030124 CCTGACTGGTCCTCCTTTCCTGG + Exonic
1193684265 X:84558002-84558024 TGAATCTGGTGCTCCTTTATTGG - Intergenic