ID: 1087652706

View in Genome Browser
Species Human (GRCh38)
Location 11:100887036-100887058
Sequence ATGCATGTCAGTACTCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087652704_1087652706 29 Left 1087652704 11:100886984-100887006 CCATGGACATGATACTGTGCTGA 0: 1
1: 2
2: 2
3: 12
4: 163
Right 1087652706 11:100887036-100887058 ATGCATGTCAGTACTCAGGATGG 0: 1
1: 0
2: 2
3: 15
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087652706 Original CRISPR ATGCATGTCAGTACTCAGGA TGG Intronic
900705351 1:4076849-4076871 ATGTATGTAAGTTCTCAGGCTGG + Intergenic
903140877 1:21338591-21338613 CTGCATGTCATTACTGAAGACGG + Intronic
906574638 1:46876755-46876777 ATACTTTTCAGTTCTCAGGATGG + Intergenic
906597335 1:47091149-47091171 ATACTTTTCAGTTCTCAGGATGG - Intronic
910020871 1:82587915-82587937 ATGCATGTCCACACTCAGTAAGG + Intergenic
916963121 1:169909100-169909122 GTGCTTGTAGGTACTCAGGATGG + Intergenic
918301866 1:183211839-183211861 ATGCATTTGAAGACTCAGGAAGG - Intronic
920708192 1:208270584-208270606 ATGCTTGCCAGTAGCCAGGATGG - Intergenic
922451226 1:225739016-225739038 ATGGAAGTCAGTGCTAAGGATGG + Intergenic
923118247 1:230964414-230964436 AAGAATGTCAGTACTCTGGAGGG - Intronic
924820940 1:247490110-247490132 TAGCATGTCAGTTGTCAGGATGG + Intergenic
1063637946 10:7802420-7802442 ATGCTTGTAAGTACACAGTATGG + Exonic
1063642056 10:7839880-7839902 ATACATGTCAGCAGTCAGCATGG + Intronic
1063871875 10:10426007-10426029 TGTCATGTCAGTACTCAGAAAGG + Intergenic
1064534671 10:16346391-16346413 CTTCATGTCAGTCCTCAGGTAGG + Intergenic
1068475517 10:57518863-57518885 ATGCATTGCAGTTGTCAGGATGG - Intergenic
1068959177 10:62849451-62849473 ATGCCAGTGTGTACTCAGGATGG - Intronic
1069105778 10:64381761-64381783 ATACATGCCAGTTGTCAGGAAGG - Intergenic
1073700135 10:105917516-105917538 ATGAATTTCAGTATTCAGGAGGG - Intergenic
1077698244 11:4414680-4414702 ATGCATGTAAGTGGTCAGGGAGG + Intergenic
1081546303 11:44074428-44074450 ATGCATGTGGGTACTGGGGAGGG + Intronic
1081590135 11:44416945-44416967 ATGCATGTCAGTAGTCCAGCTGG + Intergenic
1085706948 11:78794922-78794944 ATGCATGTCAGTACTTGAGTAGG + Intronic
1086363793 11:86087782-86087804 ATGGCTCACAGTACTCAGGAAGG - Intergenic
1087652706 11:100887036-100887058 ATGCATGTCAGTACTCAGGATGG + Intronic
1089186362 11:116618030-116618052 ATGCATGACATTACTGAGGTAGG + Intergenic
1090902357 11:131044232-131044254 ATGCATGTGGGTACACTGGATGG + Intergenic
1093772723 12:23036352-23036374 ATGAATGACAGTAATCAGGATGG + Intergenic
1095954130 12:47796907-47796929 ACGCATGGCAGTCCTAAGGAGGG + Intronic
1101570148 12:105946343-105946365 ATGGGTGTCAGTCCCCAGGACGG - Intergenic
1104246784 12:127050707-127050729 GTGCATGGCAGTGCTCAGAAAGG - Intergenic
1107030189 13:35842858-35842880 AGCCATTTCAGTAATCAGGATGG + Intronic
1111544303 13:89710399-89710421 ATTCACATCAATACTCAGGAAGG - Intergenic
1114130646 14:19788028-19788050 ATGCATGTCATTACTCAGCAGGG + Intronic
1117414546 14:55481601-55481623 ATGCATGTAAATACACAGGTTGG + Intergenic
1117848857 14:59945918-59945940 ACACATGACAGTACTCAGGCTGG + Intronic
1119530202 14:75354758-75354780 ATGAATACCAGTACTTAGGAGGG + Intergenic
1121749342 14:96335692-96335714 TGGGATGTCAGTAGTCAGGAAGG - Intronic
1122010491 14:98742280-98742302 ATGCATGTCTGCAGTCAAGACGG - Intergenic
1123573702 15:21643664-21643686 ATGCACGTCATTACTCAGCAGGG + Intergenic
1123610321 15:22086249-22086271 ATGCACGTCATTACTCAGCAGGG + Intergenic
1129264858 15:74388070-74388092 CTGCAGGTCGGTTCTCAGGAAGG - Intergenic
1129392631 15:75228154-75228176 ATGCATGTGAGGACTCAGTGAGG + Intergenic
1202982568 15_KI270727v1_random:378003-378025 ATGCACGTCATTACTCAGCAGGG + Intergenic
1141473360 16:84254416-84254438 ATGCCTGTGAATACTCAGGATGG + Intergenic
1141678903 16:85532579-85532601 ATGTAGGGCAGTAATCAGGAAGG - Intergenic
1146655406 17:34632018-34632040 ATGCAAGTCAGTATCCAGGTGGG + Intronic
1148459666 17:47831900-47831922 AAGGATGGCAGAACTCAGGATGG - Exonic
1149858039 17:60102153-60102175 ATGCGTGTCAGTACTCCAGCAGG + Intergenic
1150630460 17:66877011-66877033 ATGAATGGCAGTACCCAGCAAGG + Intronic
1150708443 17:67509275-67509297 ATGCCTGTGAGTACTTTGGAAGG + Intronic
1153396916 18:4632958-4632980 ATGCAGCTGAGTACTCATGAAGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155072840 18:22331256-22331278 GAGAATGTCAGTAATCAGGAGGG - Intergenic
1155874598 18:31070106-31070128 AAGCATGACAGTATCCAGGAAGG - Intronic
1156409431 18:36813546-36813568 ATGCATTTCAGTACTTTTGATGG + Intronic
1163685909 19:18711544-18711566 ATGCTTCTCAGACCTCAGGAAGG + Intronic
1164397907 19:27881907-27881929 ATACATTTCAGCTCTCAGGATGG + Intergenic
1168467939 19:56619052-56619074 ATGCTTGCCAGCAGTCAGGACGG + Intronic
925621361 2:5796437-5796459 ATGCATGTCTGTAGTACGGATGG - Intergenic
928865282 2:35910372-35910394 ATGCTTTTCATTACTCAGTAAGG - Intergenic
934604135 2:95681520-95681542 CTCCATGCCAGTAATCAGGAAGG + Intergenic
935237084 2:101148542-101148564 ATGCATGTATGTAAGCAGGAGGG + Intronic
936537526 2:113323754-113323776 CTCCATGCCAGTAATCAGGAAGG + Intergenic
936714141 2:115164072-115164094 AATCATGTCAATACTCAGAAAGG - Intronic
939410381 2:141816729-141816751 ATACATGTGAGTATTGAGGATGG - Intronic
945687736 2:212992741-212992763 ATGTATGTCGGTAGTGAGGAAGG - Intergenic
946567432 2:220982417-220982439 ATTCATGGCATTTCTCAGGAAGG + Intergenic
946979886 2:225199061-225199083 TTGCATCTCTGTACTAAGGATGG - Intergenic
947267985 2:228303663-228303685 ATACATTTCAACACTCAGGATGG - Intergenic
947893369 2:233645603-233645625 ATGCATGTCAGAAATCCGGCAGG + Intronic
1168842334 20:917331-917353 ATGCGTGTGAGTCCTCAGCATGG + Intergenic
1172978615 20:38924798-38924820 GTGCATGGCAGTGCTCATGATGG - Intergenic
1184061612 22:42085940-42085962 TTGCATGTCAGTAAACAGGAAGG - Exonic
949540948 3:5031621-5031643 AGGCATGTCATTCCTGAGGAGGG + Intergenic
951604218 3:24414380-24414402 ATGCCTGGAAGGACTCAGGAAGG - Intronic
952423925 3:33155835-33155857 ATGGATGTCGGAACTCAGGATGG + Intronic
952946624 3:38482262-38482284 ATACATGTCAATGCGCAGGAAGG - Exonic
953777598 3:45835021-45835043 AAGCATGCCAGAAATCAGGAAGG - Intronic
954369170 3:50161222-50161244 ATGCATGCAAGTAAGCAGGAGGG + Intronic
954494351 3:50940193-50940215 ATGCTTGTCAGTACTTTGGGAGG + Intronic
955692025 3:61600280-61600302 ATGCTTTTCAGTACCCAGAAAGG - Intronic
957860372 3:85940945-85940967 TAGCATGTCAATACTGAGGAAGG - Intronic
959136369 3:102427009-102427031 CTTCATGACATTACTCAGGAAGG - Intronic
960634014 3:119765704-119765726 ATGCTTGTCAATACACAGGATGG - Exonic
961041043 3:123678497-123678519 ATGCTTGTCAGTGCTCAGCAGGG + Intronic
961133267 3:124488294-124488316 ATGCATGTCAGCATGCTGGAAGG + Exonic
962183264 3:133231023-133231045 ATGCATGTCAGTAATCAGGGTGG - Intronic
962811478 3:138962331-138962353 ATGCGGGTCTGGACTCAGGAGGG + Intergenic
974799198 4:66793749-66793771 GTGGATGTGAGTATTCAGGAAGG - Intergenic
978531097 4:109714584-109714606 ATACATTTCAGTGCTCACGAGGG - Intronic
979145077 4:117236442-117236464 ATACATTTCAGTAATTAGGATGG - Intergenic
981428630 4:144634325-144634347 ATTCATCACACTACTCAGGATGG - Intergenic
983412769 4:167420399-167420421 ATACATTTCAGCCCTCAGGATGG + Intergenic
983709952 4:170702022-170702044 ATGTATGTCAGTACTCAACAAGG - Intergenic
987182375 5:15381196-15381218 ATGGATGTTGGTATTCAGGAAGG + Intergenic
987848273 5:23316153-23316175 GTGCAATTCAGTACTCTGGATGG - Intergenic
988055861 5:26095360-26095382 ATGCATGTCAATTTTCATGATGG + Intergenic
989215768 5:38902841-38902863 ATGCATCTGAATACCCAGGAAGG + Intronic
991093989 5:62720103-62720125 ATGCATGGCTGTCCTCAGGCTGG + Intergenic
991978843 5:72210908-72210930 AAGCATGTGAGCACTCAGGGTGG + Intergenic
994776650 5:104042861-104042883 ATGCAGGTCTTTACTCAGTAAGG + Intergenic
997426498 5:133806455-133806477 ATGCATGTCAGTAAACAAAAGGG + Intergenic
997654906 5:135547476-135547498 ATGCATGTCAGCACCCATGCAGG - Intergenic
1007509615 6:42365007-42365029 ATGCAGGTCAGCACACAGGAGGG + Intronic
1010493974 6:76510636-76510658 ATGCCTGGCAGTAGTTAGGAGGG + Intergenic
1011059257 6:83245015-83245037 ATGCATGTCAGGGCTGAAGATGG + Intronic
1011728908 6:90239750-90239772 ATGCATGTCAGTGCTGAGCTTGG - Intronic
1014198681 6:118585574-118585596 ATACATTTCAGCCCTCAGGATGG + Intronic
1015073392 6:129124899-129124921 ATTGATGTCAGAACACAGGAGGG + Intronic
1016915663 6:149242085-149242107 ATGGATGTCACTGCTCGGGATGG + Intronic
1018244103 6:161805433-161805455 GTGCATGTGTGTACTCAGGAAGG - Intronic
1019569355 7:1703450-1703472 ATACTTATCAGTTCTCAGGAGGG - Intronic
1021297414 7:18925358-18925380 ATGCATTTCAGCACTTAGCATGG + Intronic
1021591487 7:22268402-22268424 ATGCATACCAGTACTTACGAAGG - Intronic
1022209990 7:28199113-28199135 ATGTCTGTAAGTACTTAGGATGG + Intergenic
1022609795 7:31858363-31858385 ATGCCTGACAACACTCAGGAGGG + Intronic
1023752451 7:43385306-43385328 CTGTCTGTCAGTACGCAGGAGGG - Intronic
1024943128 7:54782730-54782752 ATGCATGTCACCACTCAGAATGG + Intergenic
1029858945 7:103548575-103548597 ATGCATGCCTGTTCTCAGAATGG - Intronic
1030535968 7:110767681-110767703 ATGCAAGTCAGCACTAAGCAGGG + Intronic
1030635502 7:111943581-111943603 AAGCCTGTCTGTTCTCAGGATGG - Intronic
1031142806 7:117963405-117963427 ATGCATGTCAGTCCTGGGGGAGG - Intergenic
1034074778 7:148221228-148221250 ATGCATGGCACCATTCAGGATGG - Intronic
1040766183 8:50914030-50914052 ATGTATTTCAGAACTTAGGAAGG - Intergenic
1042229301 8:66540580-66540602 AGGCATCTCAGAACACAGGATGG - Intergenic
1044798374 8:95927677-95927699 ATTCATGGCAGTACTCAGACTGG - Intergenic
1049044168 8:140136423-140136445 ATGCATGTATGTGCTCAGTAAGG - Intronic
1050426410 9:5516732-5516754 AGGCATGTGGGTGCTCAGGATGG - Intronic
1051986106 9:23089336-23089358 CTGCATGTGGGTACTCAGAAGGG - Intergenic
1186503106 X:10067839-10067861 ATGCATGTCAGTTTTGAAGAGGG + Intronic
1187045609 X:15645757-15645779 ATACATGGATGTACTCAGGATGG + Intronic
1187989872 X:24858763-24858785 AAGCATGTCAGTACTGAAGTAGG + Intronic
1188859353 X:35238473-35238495 GTGCCTATCAGGACTCAGGATGG + Intergenic
1189391673 X:40581394-40581416 ATGCATCTCCGTACTCTGAAGGG - Intronic
1190452840 X:50598133-50598155 AAGCATGTGAGCACTGAGGATGG - Intronic
1192859641 X:75053085-75053107 ATGAATGTCAGGCCTCAAGAGGG + Intergenic
1193352642 X:80480443-80480465 ATACATTTCAGCCCTCAGGATGG + Intergenic
1194392271 X:93333941-93333963 ATGCACGTGAGTACACATGAAGG + Intergenic
1195805422 X:108760096-108760118 ATACAAGACAGTAATCAGGAAGG + Intergenic
1201063169 Y:10066502-10066524 CAGGATGTCAGTACTCAGTATGG - Intergenic
1202116198 Y:21470746-21470768 GAGGATGTCAGTACTCAGCATGG + Intergenic