ID: 1087658467

View in Genome Browser
Species Human (GRCh38)
Location 11:100956018-100956040
Sequence GGTCTGAGAAGAGGACAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 1, 2: 3, 3: 31, 4: 422}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087658467_1087658469 -6 Left 1087658467 11:100956018-100956040 CCATCTTGTCCTCTTCTCAGACC 0: 1
1: 1
2: 3
3: 31
4: 422
Right 1087658469 11:100956035-100956057 CAGACCTCAGAAGAAATTGCTGG 0: 1
1: 0
2: 2
3: 14
4: 214
1087658467_1087658472 9 Left 1087658467 11:100956018-100956040 CCATCTTGTCCTCTTCTCAGACC 0: 1
1: 1
2: 3
3: 31
4: 422
Right 1087658472 11:100956050-100956072 ATTGCTGGGTGCTCAAGTGAAGG 0: 1
1: 0
2: 2
3: 33
4: 436
1087658467_1087658473 28 Left 1087658467 11:100956018-100956040 CCATCTTGTCCTCTTCTCAGACC 0: 1
1: 1
2: 3
3: 31
4: 422
Right 1087658473 11:100956069-100956091 AAGGCGCTGTCTATAGTTGATGG 0: 1
1: 0
2: 0
3: 4
4: 50
1087658467_1087658470 -5 Left 1087658467 11:100956018-100956040 CCATCTTGTCCTCTTCTCAGACC 0: 1
1: 1
2: 3
3: 31
4: 422
Right 1087658470 11:100956036-100956058 AGACCTCAGAAGAAATTGCTGGG 0: 1
1: 0
2: 1
3: 12
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087658467 Original CRISPR GGTCTGAGAAGAGGACAAGA TGG (reversed) Intronic
900004666 1:36813-36835 TGGCTGAGATGAGGACAGGAGGG + Intergenic
900107723 1:992056-992078 GGTCCCAGAAGAGGGGAAGAAGG - Intergenic
900608709 1:3535474-3535496 GGTCTGTGTGGAGGACCAGAGGG - Intronic
901795505 1:11677181-11677203 AGTCTGAGATCAGGACTAGATGG + Intronic
903010761 1:20328515-20328537 GATCTAAGAAGAGGAAGAGAGGG + Intronic
903181705 1:21608254-21608276 GGGCGGCGACGAGGACAAGATGG - Exonic
903467041 1:23559017-23559039 TGTCTGATTAGAGGAAAAGAGGG + Exonic
903607380 1:24584861-24584883 GGACTGAGAAGACGCAAAGAGGG - Intronic
904858015 1:33514606-33514628 GGTCTGAGAGGGGCATAAGAAGG + Exonic
906060984 1:42948440-42948462 GCTGTGGGAAGAGGACAAGATGG - Intronic
906683148 1:47744563-47744585 GGAATGAGGAGAGGACAGGAAGG + Intergenic
907074908 1:51569269-51569291 GTTCTCAGAAGAGGAGAAGGAGG - Intergenic
907353044 1:53849164-53849186 GGACTGAGAAGAGGAAGAGGGGG + Intergenic
908036699 1:60062137-60062159 GGTCTGAAGAGAGGAGAGGAGGG - Intronic
908384337 1:63626867-63626889 GGGCTCAGAAGAGGGAAAGATGG - Intronic
908774726 1:67628731-67628753 GGTCTGAGGAAAGGAGTAGAGGG - Intergenic
908794446 1:67817233-67817255 GGGGAGAGAAGAGGACAAGAAGG + Intronic
909087194 1:71181844-71181866 GGTCAGAGAAGAGAATAGGAGGG - Intergenic
909660756 1:78079184-78079206 GGGATGAAAAGAGGACAAGTTGG + Intronic
909794826 1:79720019-79720041 GGGCTCAGAAGAAGACAGGAAGG - Intergenic
913192589 1:116426209-116426231 GCTGTGGGATGAGGACAAGAAGG + Intergenic
913569142 1:120102830-120102852 AGTCAGGGAAGAGGTCAAGAGGG + Intergenic
914289951 1:146263821-146263843 AGTCAGGGAAGAGGTCAAGAGGG + Intergenic
914550994 1:148714604-148714626 AGTCAGGGAAGAGGTCAAGAGGG + Intergenic
915004753 1:152625668-152625690 GGTGTGAGAGAAGGACAGGAGGG + Intergenic
915588849 1:156859556-156859578 GGTCTCCAAAGAGGACAAGGAGG - Intronic
915725536 1:158014477-158014499 GGTGGGAGAAGAAGGCAAGACGG - Intronic
916017834 1:160765834-160765856 TGTCTGAGGGGAGGAGAAGATGG + Intergenic
916319062 1:163481984-163482006 TATCAGAGAAGAGGACAAGCTGG - Intergenic
917418628 1:174838421-174838443 GTTCTGAGATGTGGTCAAGATGG - Intronic
917563774 1:176188777-176188799 GGCCTGAGGAGAGGAAGAGAGGG - Intronic
917982128 1:180276383-180276405 GGTCAGAGAAGAGGGCCCGAAGG - Exonic
918404844 1:184201503-184201525 GAGCAGAGAAGAGGACAAGGTGG - Intergenic
919263453 1:195229906-195229928 GGAAGGAGAAGAGAACAAGAAGG + Intergenic
919809240 1:201398788-201398810 GGTCAGTGAAGAGGACTGGAGGG - Intronic
920040031 1:203089677-203089699 GCTCTGAGAGAAGAACAAGATGG - Intergenic
920456693 1:206107145-206107167 GGACAGAGAGGAGGACAGGAGGG - Intergenic
921487786 1:215734914-215734936 GGGCTCAGAAGAAGACAGGAAGG - Intronic
922125128 1:222713614-222713636 GGTCGCAGAAGGGGAGAAGATGG + Intronic
923458411 1:234186454-234186476 GCTCTGAGAAGGAGACAAGCTGG + Intronic
924710692 1:246527910-246527932 GGTCTCAGCAGATCACAAGATGG + Intergenic
1063093537 10:2889670-2889692 GCGCTGAGAAGCGGAAAAGAAGG + Intergenic
1063529762 10:6819695-6819717 GGGCTGAGGAGAGGAGAAGGAGG + Intergenic
1065629584 10:27664423-27664445 GGAGAGAGAAGAGGAGAAGAGGG + Intergenic
1066083386 10:31954417-31954439 GGGCTCAGAAGAAGACAGGAAGG + Intergenic
1066218893 10:33316120-33316142 CTTCTGAGCAGAGGGCAAGAAGG + Intronic
1066523345 10:36247822-36247844 GGGGAGAGAAGAGGAGAAGAGGG - Intergenic
1066650567 10:37651246-37651268 GATCTGAGCATAGGACAGGAAGG + Intergenic
1067021531 10:42803897-42803919 GGTGATGGAAGAGGACAAGATGG - Intronic
1067664694 10:48266935-48266957 GGTGTCAGCAGAGGACTAGAGGG + Intronic
1068613127 10:59082705-59082727 GGACTGAGAAGAGTGAAAGAGGG - Intergenic
1068856949 10:61807597-61807619 TGTCTGAGAGCAGGAGAAGATGG - Intergenic
1069550676 10:69361680-69361702 GGACTGAGAAGAGGGGACGATGG - Intronic
1069804932 10:71116066-71116088 GGGCTCAGAAGAAGACAGGAAGG + Intergenic
1070051642 10:72895496-72895518 AGTGAGAGAAGAGGAAAAGAAGG + Intronic
1071273242 10:84028184-84028206 GATTTGGGAATAGGACAAGAAGG + Intergenic
1072002939 10:91215608-91215630 GCTCTGAGAAGAGGCCCTGAAGG - Intronic
1073612688 10:104959902-104959924 GTACTGAGGAAAGGACAAGAGGG - Intronic
1074543266 10:114383909-114383931 AGACTGAGAAGAAGAGAAGATGG - Intronic
1074755561 10:116621741-116621763 ACTCTGAGAAGAGGACACGTGGG - Intronic
1075992434 10:126849360-126849382 TTTCTGGGAAGAGGACAGGAAGG + Intergenic
1076328524 10:129646980-129647002 GACCTGAGAAGAGGAAATGAGGG + Intronic
1079015158 11:16862503-16862525 GGTAAAAGAAGAGGACAAGAAGG + Intronic
1081570256 11:44286330-44286352 GGTATGAGAAGAGGAGATGGAGG + Intronic
1081745290 11:45468578-45468600 GGTCTGTGAAAAGGAGAAGGTGG - Intergenic
1081827894 11:46075631-46075653 TGTCTGTGGAGAAGACAAGATGG + Intronic
1082959407 11:58904884-58904906 GGTCAAAGAAGGGGAGAAGATGG - Intergenic
1083485474 11:62980890-62980912 GGCCAGAGAAGAGGGCAGGAAGG - Intronic
1083636324 11:64122817-64122839 GGCCTGAGCAGAGGACAGGCTGG + Intronic
1083722353 11:64609630-64609652 GGTTTGAGAGGAGGACCAGGAGG - Intronic
1085107822 11:73861305-73861327 GGGCTGTGAAGAGGAAAAGCAGG - Intronic
1085405754 11:76260773-76260795 GCTCTGAGACAAGGAAAAGAAGG + Intergenic
1086477941 11:87199604-87199626 GGTCTGAGTAAAGGAGAAGATGG + Intronic
1087658467 11:100956018-100956040 GGTCTGAGAAGAGGACAAGATGG - Intronic
1088368073 11:109059847-109059869 GCTCAGAGAAGAGAAAAAGAGGG - Intergenic
1089299147 11:117487981-117488003 GGTCTCAGGAGAGGGAAAGACGG + Intronic
1089642723 11:119858354-119858376 TCACTGAGAAGAGGAGAAGATGG + Intergenic
1090044641 11:123320395-123320417 GGTGTGGGGAGAGGTCAAGAAGG + Intergenic
1091069602 11:132550703-132550725 TGTCTGAGAAGAGGAAGGGACGG + Intronic
1091704674 12:2685772-2685794 GCTCCCAGAGGAGGACAAGAGGG + Exonic
1091711246 12:2742110-2742132 GCTCCCAGAGGAGGACAAGAGGG + Intergenic
1091797193 12:3304169-3304191 GGTCTGTGAGGTGGGCAAGATGG + Intergenic
1092291367 12:7161267-7161289 GGACTAAGACGATGACAAGAAGG - Intergenic
1092389337 12:8061925-8061947 GGGCTGAGAAAAGGAGAAAATGG - Intronic
1093235917 12:16608202-16608224 GCACTGAGAAGAAGAAAAGAGGG + Intronic
1094073728 12:26449750-26449772 GCAATGAGAAGAGGACTAGAAGG + Intronic
1094753441 12:33439564-33439586 GGTACGGGAAGAGGAAAAGACGG - Exonic
1095978541 12:47956681-47956703 GGGCTCAGAAGAAGACAGGAAGG + Intergenic
1096464543 12:51841082-51841104 GGGCTGGGAAGAGGGCAGGAGGG - Intergenic
1097324482 12:58260332-58260354 GGTGTGAGAAGAGGGCAAAGGGG - Intergenic
1098433397 12:70444613-70444635 GGGCTCAGAAGAAGACAGGAAGG + Intergenic
1098744237 12:74215449-74215471 GGTCTGAGAAGAGGAAAAGAGGG + Intergenic
1098875610 12:75863779-75863801 CGTCTGAGGGCAGGACAAGATGG - Intergenic
1099412201 12:82344845-82344867 GCTCTGAGGAGAGGACTACATGG + Intronic
1099592409 12:84611593-84611615 GGTCTGAGGAGAGGCAGAGATGG - Intergenic
1101396404 12:104352234-104352256 GGTCTGAGGGCAGGAGAAGATGG - Intergenic
1101574418 12:105984156-105984178 CGTCTGAGAGGAGGATAAGTGGG - Intergenic
1101815553 12:108143514-108143536 GCTCTGAGATGGGGACTAGATGG - Intronic
1103738176 12:123073865-123073887 TGTCTGAGAAGAGAAAAGGAAGG - Intronic
1103757817 12:123223665-123223687 GGTTTGAGAAGATGACAATTAGG - Intronic
1103958443 12:124592708-124592730 GGTGTGAGGAGAGGCCAAGTTGG - Intergenic
1103964233 12:124628104-124628126 GGACTGAGGAGAGGGAAAGAGGG - Intergenic
1105271649 13:18881959-18881981 GATCTGAGAGGATGACAAAAGGG + Intergenic
1108420855 13:50248135-50248157 GGTGGGAGATGAGGCCAAGAGGG - Intronic
1108568842 13:51729487-51729509 GCACTGAGAAGAGGAGAAGTGGG - Intronic
1110520359 13:76469005-76469027 GGTCTTAGAAGAGTAGAAGGAGG + Intergenic
1110758311 13:79201758-79201780 GATCTTGGAAGAGGAAAAGATGG - Intergenic
1112431936 13:99357954-99357976 GGTCTACAAACAGGACAAGATGG + Intronic
1113066720 13:106380265-106380287 GGTCTGAGGAGAGGATGAGGTGG - Intergenic
1113561434 13:111284758-111284780 GGTGTGAGAAGAGGACATGGAGG + Intronic
1113871948 13:113565040-113565062 GGTCTGAGGAGAGGTTACGAGGG - Intergenic
1114446036 14:22788896-22788918 GGACTGGGAAGAGCATAAGAAGG + Intronic
1117006568 14:51426713-51426735 TCTCTGAGAAGAGAACGAGAAGG - Intergenic
1117118095 14:52537110-52537132 GGGCTGGGAAGAAGGCAAGAAGG + Intronic
1117805783 14:59489540-59489562 GGTCTCAGAAGAAGACAGGAAGG - Intronic
1118335467 14:64850161-64850183 TACCTGTGAAGAGGACAAGAAGG + Intronic
1118692999 14:68358023-68358045 GGCCTGAGAAGAGGAAAAGATGG + Intronic
1118997542 14:70850300-70850322 GGGCTGGGAAGAGGAGAAAATGG + Intergenic
1119410854 14:74429278-74429300 GGGAGGAGAAGAGGACACGAGGG - Intergenic
1119457002 14:74764157-74764179 TGCCTGAGAAGAGGGCAAGTAGG - Exonic
1120657508 14:87210792-87210814 GTTCAGAGAAGAAGACAAAAGGG - Intergenic
1121324941 14:93014369-93014391 TGTCTGGGAAGTGGGCAAGAGGG + Intronic
1121891885 14:97602297-97602319 GGGATGAGAAGAGGATGAGAGGG + Intergenic
1122251872 14:100445622-100445644 GGGCTGAGACGGGGACAGGATGG + Intronic
1124490584 15:30152525-30152547 GGTCTGAGAGGGGGCAAAGAGGG + Intergenic
1124752949 15:32385804-32385826 GGTCTGAGAGGGGGCAAAGAGGG - Intergenic
1124841520 15:33246308-33246330 GGGCTGAGTAGAGGCCAAAAGGG + Intergenic
1124974692 15:34521504-34521526 GGTCTGAGAGGGGGCAAAGAGGG - Intergenic
1126376466 15:48001790-48001812 GGTTATAGAAGAGGCCAAGAGGG + Intergenic
1126892746 15:53223564-53223586 TGTGTGAGTAGAGGACAATAGGG + Intergenic
1128219484 15:65958122-65958144 AGTGTGGGAACAGGACAAGAAGG + Intronic
1128391867 15:67187750-67187772 GGGCTGGGATGAGGATAAGATGG - Intronic
1128629806 15:69253123-69253145 GGTATGAGGAGGGGAGAAGAGGG - Intronic
1128902829 15:71440970-71440992 GGTCTGAGAAGAGCCAAAGAAGG - Intronic
1129476896 15:75791756-75791778 GGTCTGAGAATGGGCAAAGAAGG + Intergenic
1131017841 15:89072470-89072492 GGTCTCAAAAGAGGAAAGGAGGG + Intergenic
1131168563 15:90160356-90160378 GTGGTGACAAGAGGACAAGATGG - Intergenic
1132448842 15:101954130-101954152 TGGCTGAGATGAGGACAGGAGGG - Intergenic
1133447403 16:5873906-5873928 GGCCTGAGAAAAGGAAGAGATGG + Intergenic
1133660004 16:7907139-7907161 TGTCTGAGGACAGGAGAAGATGG - Intergenic
1133890129 16:9871129-9871151 GGTGTGACAGGAGGACAAGATGG - Intronic
1134319642 16:13150915-13150937 GGTTTGAGATGAGGGCAAAAAGG - Intronic
1134555667 16:15161826-15161848 GGTCTGGTAAGAAGAAAAGATGG + Intergenic
1135832599 16:25789266-25789288 GGAGGAAGAAGAGGACAAGAAGG - Intronic
1136017240 16:27408544-27408566 GGTCAGAGAGGAGGACCAGCAGG + Intronic
1137765248 16:50973052-50973074 GGTCTGAGAGCTGGACAGGAAGG + Intergenic
1137924224 16:52524639-52524661 GGACTGGGAAGAGGAAGAGAGGG - Intronic
1138451268 16:57094511-57094533 GGACTGGGAGGAGGACCAGATGG - Intronic
1138603278 16:58070657-58070679 GGTATGAGAAGAAGGCAGGATGG - Intergenic
1138622080 16:58219536-58219558 AGTCTGAGTACAGGACAAGCTGG - Intergenic
1142639504 17:1277635-1277657 GGACTGAGAGGAGGACGAGGCGG + Intergenic
1143456079 17:7068811-7068833 GGGCTCAGAAGAAGACAGGAAGG - Intergenic
1144009237 17:11130247-11130269 GGGCTGAGAAGAGGATGTGAAGG + Intergenic
1144422992 17:15114876-15114898 GGTGTGAGGAGAGAGCAAGAGGG + Intergenic
1144565260 17:16354103-16354125 GGTCTGAAAAAAGAAGAAGAAGG - Intergenic
1144783745 17:17820519-17820541 TGTCTGTGAAAAGGAGAAGAGGG + Exonic
1145052939 17:19678254-19678276 GCTCTGAGAAGGGGACCAGTGGG - Intergenic
1145262189 17:21361054-21361076 GGCCTGGGAAGAGGATAAGGAGG + Intergenic
1146494346 17:33307608-33307630 GGTCTAAGAAGATGAGTAGAAGG - Intronic
1146831481 17:36073118-36073140 GACCTGAGAAGGGGTCAAGAAGG - Intergenic
1146845593 17:36179711-36179733 GGTGAGAGAAGTGGAAAAGAAGG + Intronic
1146873810 17:36391552-36391574 GGTGAGAGAAGTGGAAAAGAAGG + Intronic
1146881167 17:36442642-36442664 GGTGAGAGAAGTGGAAAAGAAGG + Intergenic
1146951972 17:36913022-36913044 AGTCTGAGGGGAGGAGAAGATGG - Intergenic
1147065580 17:37921319-37921341 GGTGAGAGAAGTGGAAAAGAAGG - Intergenic
1147250610 17:39150951-39150973 TGGCAGAGAAGAGGAAAAGAAGG + Intronic
1147330456 17:39696177-39696199 TGTCTGACAAGAGGAGAGGAAGG - Intronic
1147549078 17:41425751-41425773 GGCCTAAGGAGAGGGCAAGAAGG + Intergenic
1147933994 17:44001189-44001211 GGGCTGAGATGCGGCCAAGAAGG + Intronic
1148206393 17:45783007-45783029 GTGCTGAGAAGAGGGCAGGAGGG + Intergenic
1148864364 17:50620871-50620893 TGTGGGAGAAGAGGACACGATGG + Intronic
1149390077 17:56180086-56180108 TGTATGAGAAGAGGAATAGAAGG - Intronic
1150108079 17:62477260-62477282 GGTAGGAAAAGAGGGCAAGATGG - Intronic
1150226086 17:63525160-63525182 GGTGTGAGATGAGGCCAAGCGGG + Intronic
1151344217 17:73491895-73491917 GATCTGAGAGGAGGCCAGGAGGG + Intronic
1151479182 17:74360341-74360363 GGTGTGAGCAGAGGGCAAGGTGG + Intronic
1152106890 17:78335440-78335462 GGACAGAGAAGAGGGCAGGAGGG - Intergenic
1152630483 17:81408685-81408707 GGTCATAGAAGGGGACAAGAAGG - Intronic
1153656414 18:7286685-7286707 TGTCTGAGGACAGGAAAAGAGGG + Intergenic
1154432897 18:14321976-14321998 GGTCTTGGAAGAAGACAGGAAGG + Intergenic
1157591729 18:48840263-48840285 GGTCTGTGAAGGGGGCAAGGTGG + Intronic
1157892444 18:51430613-51430635 GGTCAGAGAAGAAGTCAGGAGGG - Intergenic
1158340963 18:56465736-56465758 GGTGTGAGAAGAAGACTGGAAGG + Intergenic
1158376455 18:56875248-56875270 GGTCTGAGAAGATGGAAATATGG - Intronic
1158675671 18:59515874-59515896 GGTTTGAGGAGAGGACAAAAGGG + Intronic
1159778425 18:72631264-72631286 GCTCTGGAAAGAAGACAAGAGGG + Intronic
1160175287 18:76588786-76588808 GGTCTGAGAAAATAACAATAAGG + Intergenic
1160237680 18:77098965-77098987 GGGGAGAGAAGAGGAGAAGAGGG - Intronic
1160636418 19:78422-78444 TGGCTGAGATGAGGACAGGAGGG + Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161701651 19:5799264-5799286 GGGCTGCGGAGAGGGCAAGAGGG - Intergenic
1163156474 19:15442574-15442596 GGAATGAGAAGGGGACAGGAGGG - Intronic
1163295131 19:16406782-16406804 GGCATGACAGGAGGACAAGAGGG + Intronic
1163678747 19:18668804-18668826 GATCTCAGTGGAGGACAAGAAGG + Exonic
1163738603 19:18996969-18996991 GGTCTGAGCAGGGGACAGGTGGG + Intronic
1164053624 19:21603929-21603951 GGTCTCAGGAGAGGCCAACATGG + Intergenic
1164441134 19:28281771-28281793 GGTTGGAGAAGAAGAGAAGAGGG - Intergenic
1164441565 19:28283754-28283776 AGTGGGAGAAGAAGACAAGACGG - Intergenic
1164849092 19:31465771-31465793 GGTCTTTGAAGATGACAGGAAGG + Intergenic
1165278690 19:34777812-34777834 GGTCTGGGAGGAGGATAAGTGGG + Intergenic
1165747387 19:38238040-38238062 GGTCAGAGAAGAGGTCAGGCTGG + Intergenic
925989865 2:9246007-9246029 GTTCTGTGAAAAGGACAGGAGGG + Intronic
926176290 2:10595218-10595240 TGTCTGAGAAGAGGTGAAAATGG + Intronic
926369956 2:12169707-12169729 GGTATGGGAAGATGCCAAGATGG + Intergenic
926704811 2:15829452-15829474 GGTCTGAGAGCAGGACAAGATGG + Intergenic
927335098 2:21912445-21912467 GGGATGAGAAGAGGAGAAGGAGG - Intergenic
927774288 2:25890107-25890129 GGGCTGAGGAGAGGGGAAGATGG - Intergenic
929147401 2:38718801-38718823 TCTCTGAGAAGAGGAACAGACGG - Intronic
930880455 2:56264388-56264410 GGTCTTAGAAGTAGAAAAGATGG - Intronic
931061673 2:58536435-58536457 GGTCTGAGAATTGGACAGTATGG + Intergenic
931863362 2:66380924-66380946 GCTGGGAGAAGAGGAGAAGAAGG - Intergenic
932440356 2:71730977-71730999 AGACAGTGAAGAGGACAAGAAGG - Intergenic
933040221 2:77455570-77455592 GGTTTGAGAATAGGAAAAAAGGG - Intronic
933439882 2:82298605-82298627 GTGCTCAGAAGAGAACAAGAAGG - Intergenic
934069970 2:88374718-88374740 GAGCAGAGAAGAGGAGAAGAAGG + Intergenic
934845372 2:97658735-97658757 AGTCTGAAGAGAGGACACGAGGG + Intronic
935180781 2:100689463-100689485 GGGCTGAGAGGAGCTCAAGAGGG + Intergenic
936029764 2:109061992-109062014 GGTCTGTGAGGATGACAGGAGGG - Intergenic
936565063 2:113576628-113576650 TGGCTGAGATGAGGACAGGAGGG - Intergenic
938768612 2:134480981-134481003 GGTCTGAGAAAGGGACGTGAAGG - Intronic
938974278 2:136460413-136460435 GGGCTCAGAAGAAGACAAGAAGG - Intergenic
939220923 2:139300501-139300523 CTTATAAGAAGAGGACAAGAAGG - Intergenic
939546131 2:143555956-143555978 GAGCTGAGAAGAGGAGAGGAAGG + Intronic
939997175 2:148930838-148930860 AGTGTGAGAGGAGGAGAAGATGG - Intronic
940035525 2:149309010-149309032 TGTCTGAAAAGAGAACAAGATGG + Intergenic
940621636 2:156120919-156120941 GGGCTCAGAAGAAGACAGGAAGG + Intergenic
940987683 2:160064522-160064544 GGTCTGTGAGTAGGATAAGAAGG + Intergenic
942821362 2:180119668-180119690 GGTCTGAGGAGAGGACATTTCGG - Intergenic
945272962 2:207960272-207960294 GCTATGATAAGAGGACATGATGG + Intronic
946099111 2:217303582-217303604 GGGCTGAGAAGAGGAAAAGGTGG - Intronic
946147897 2:217744588-217744610 GGACTGTGCAGAGGACAAGATGG - Intronic
946398557 2:219456095-219456117 GGTCTGTGAGGAGGGCAAGTTGG + Intronic
947020725 2:225672795-225672817 GGCCTGAGGAGAGGAAGAGATGG + Intergenic
947331337 2:229032601-229032623 GGACTTGGAAGATGACAAGAGGG + Intronic
948937291 2:241175335-241175357 GGTCTGGGAAGGGGAAAATAGGG - Intronic
1169573309 20:6930030-6930052 CATCTGAGATGAGGACATGAAGG - Intergenic
1170442335 20:16391546-16391568 GGACTGAGAAGAGGACATTCAGG + Intronic
1170781270 20:19427672-19427694 GGCCTGGGAGGAGGACAAGTCGG - Intronic
1171167406 20:22984159-22984181 GGGGGGAGCAGAGGACAAGATGG - Intergenic
1172213581 20:33217772-33217794 GGTCTAAGAAAAAGAGAAGAGGG - Intronic
1172366111 20:34350989-34351011 GGTTTGAGAACAAGAAAAGAAGG + Intergenic
1173659045 20:44720289-44720311 GGTTTAAGCAGAGGCCAAGAAGG - Intronic
1174102113 20:48135715-48135737 TGTCTAAAAAGAGCACAAGACGG - Intergenic
1175314747 20:58039552-58039574 GGCCTGGGAAGAGGACAGCAGGG + Intergenic
1176092226 20:63323558-63323580 GGTCTGTGAAGAGGTGAAGCTGG - Intronic
1177831006 21:26138885-26138907 GGTCAAAGAAGAGGAAAAGGAGG + Intronic
1178451232 21:32703073-32703095 GGTCTGAAAAGAGGTGAAGCAGG - Intronic
1179116138 21:38494222-38494244 GGTCAAAGGAGGGGACAAGAAGG + Intronic
1180109289 21:45640550-45640572 GCTTTGTGAAGAGGACATGAGGG + Intergenic
1180661220 22:17468941-17468963 GGTGAGAGAAGTGGGCAAGATGG + Intronic
1181822083 22:25484262-25484284 AGTCTGAGAAGATGAGTAGAAGG - Intergenic
1182357333 22:29728220-29728242 GGATGGAGAAGAGGAGAAGAAGG - Intronic
1183663346 22:39234054-39234076 AGACAGAGAAGAGGAGAAGAGGG + Intronic
1183843407 22:40519344-40519366 GGTTTGAGAAGAGTTCTAGAGGG - Intronic
1184415710 22:44350744-44350766 CGTCTGATCAGAGGACGAGATGG + Intergenic
1184997947 22:48223962-48223984 GGGCTGAGAAGATGACAGGGTGG + Intergenic
949110390 3:254035-254057 GGTCTGAGCAGAGAACCAGGAGG - Intronic
950420721 3:12897553-12897575 GTGCTGAGCACAGGACAAGAGGG - Exonic
950567040 3:13775747-13775769 GGTATGAGGAGAGGAGAAGCAGG - Intergenic
950767990 3:15288150-15288172 GGTCTGAATAGAGCAAAAGAGGG - Intronic
951017124 3:17743034-17743056 GGACTGAGAAGGGGAGCAGAGGG + Intronic
953063013 3:39443497-39443519 AGTCTGAGATGAGGAAAACAGGG + Intergenic
954639324 3:52088746-52088768 GCTCTGAGAAGAGGAAGGGAGGG - Intronic
957307215 3:78473051-78473073 GGTCTGATTAGAGTATAAGATGG - Intergenic
957876579 3:86154666-86154688 TGTCTGAGAGCAGGAAAAGATGG + Intergenic
960650859 3:119948267-119948289 GGTCAGAAAAGAGGCCAAGAAGG + Intronic
960696911 3:120405486-120405508 GCACTGAGAACAGGACAAGGAGG - Intronic
960902893 3:122569736-122569758 GGCCTCAGAACTGGACAAGAAGG + Exonic
962003965 3:131329666-131329688 TCTCTGAGAAGATGACATGAGGG + Intronic
962544303 3:136416639-136416661 GGTCTGAGATGAAGAGAGGATGG + Intronic
962717486 3:138139187-138139209 TGTCTGAGAGCAGGAGAAGATGG - Intergenic
963252445 3:143115781-143115803 TATCAGAGAAGAGAACAAGAGGG - Intergenic
964305100 3:155331430-155331452 GCTATGAGCAGATGACAAGAAGG - Intergenic
964922675 3:161916821-161916843 TGTCTCAGAAGAGGAAAAGTAGG - Intergenic
965666040 3:171094495-171094517 GGGCAGAGAATAGGTCAAGAGGG - Intronic
966168022 3:177043212-177043234 GGACTGAGAAGATGGGAAGAGGG - Intronic
966773385 3:183523427-183523449 GGCCTGAGAAGAGCCCAGGAGGG - Intronic
967392969 3:188975178-188975200 TGTCAGAGAAGAGGAGAAGCAGG - Intronic
967404895 3:189104463-189104485 AGTCTGATTAGAAGACAAGATGG - Intronic
967767772 3:193300500-193300522 GGTTTGAGAAGTGAATAAGAGGG - Intronic
970036083 4:11737573-11737595 GGGCTGAGAAGAAGACAGGAAGG + Intergenic
970057007 4:11985571-11985593 GGGCAGGGAAGAGGAGAAGATGG + Intergenic
970374472 4:15442688-15442710 GGTCTGAGAAGAGGCCATTCTGG - Exonic
971573963 4:28250758-28250780 TGTGTAAGAAGAGCACAAGAGGG + Intergenic
972257511 4:37373753-37373775 GGTCAGAGATCAGGACAAAAGGG + Intronic
972561252 4:40230944-40230966 GGTCTCAGAAGGGAACAAAAAGG - Intronic
973263009 4:48183562-48183584 AGTCTGAGAGCAGGAGAAGATGG - Intronic
975393094 4:73842954-73842976 GGGGAGAGAAGAGGAGAAGAGGG - Intronic
975444614 4:74447715-74447737 GTTCTGAGAACCAGACAAGAGGG - Intronic
976058542 4:81098650-81098672 GGTCTGAGTAGAGGGAGAGATGG + Intronic
977122082 4:93114614-93114636 GGTCAGAGAACAGTACAATAGGG - Intronic
977805146 4:101288563-101288585 GGTCGGAGGAGGGGATAAGAGGG + Intronic
977956241 4:103030089-103030111 AGTTTGAGAAGAGGATGAGAAGG + Intronic
978145319 4:105365484-105365506 GGGCTCAGAAGAAGACAGGAAGG + Intergenic
978501353 4:109413291-109413313 GGCCTAAGAAGAGGAGAAGAGGG + Intergenic
979951427 4:126898092-126898114 GGGCTCAGAAGAAGACAGGAAGG - Intergenic
980333485 4:131439807-131439829 GGACTGAGCAGAGGACTTGAAGG - Intergenic
981054241 4:140343620-140343642 GGTCTGAAAATTGAACAAGATGG + Intronic
981120226 4:141041359-141041381 GGGGTCAGAAGAGGACAAAAGGG + Intronic
981343242 4:143646981-143647003 GGGCTCAGAAGAAGACAGGAAGG + Intronic
981597513 4:146444575-146444597 GGTTAAAGAAGAGAACAAGAGGG - Intronic
981698802 4:147585525-147585547 CGTGTGAGGAAAGGACAAGAAGG - Intergenic
982189139 4:152835588-152835610 GGGCTCAGAAGAAGACAGGAAGG - Intronic
982503996 4:156195294-156195316 GGTTTGTGAGGAGGACCAGAGGG + Intergenic
982797668 4:159664909-159664931 GGGCTCAGAAGAAGACAGGAAGG - Intergenic
983039232 4:162905599-162905621 GGGCTCAGAAGAAGACAGGAAGG + Intergenic
983497601 4:168460973-168460995 GGTATGAGAAGAGGGGCAGATGG + Intronic
983700867 4:170591884-170591906 TGTCTGGGAAGAGGAAAGGAGGG + Intergenic
983732300 4:171011057-171011079 GGTCTCAGAAGAAGACAAGAAGG + Intergenic
983995488 4:174176534-174176556 GGACTGTGAAAAGGACAGGAGGG + Intergenic
984935852 4:184888837-184888859 GGCTTGAGAAGAGGAGAAGGGGG + Intergenic
985074044 4:186195306-186195328 GCTCAGAGAAGAGAGCAAGAAGG + Intronic
985392612 4:189506035-189506057 GGGCTGAGGAAAGGACGAGAAGG - Intergenic
985652205 5:1112367-1112389 GGTCGGGGAAGGGGACAAGAGGG - Intergenic
986593986 5:9401507-9401529 GAGCTGAGAAGAGGACCACACGG - Intronic
986887325 5:12256036-12256058 GGCCTGAGAAGGGGACCAGGTGG + Intergenic
987000686 5:13656257-13656279 GGCCTGAGAAGAGGCAAGGAGGG + Intergenic
987169505 5:15239733-15239755 GGGCTCAGAAGAAGACAGGAAGG + Intergenic
987474534 5:18374636-18374658 GGTCTGGGAAGAGAAGAAAAAGG - Intergenic
988663193 5:33296405-33296427 AGTATGAGAAGAAGACAAGAAGG - Intergenic
988832950 5:35004896-35004918 TGTCTGAGAACAGAATAAGATGG + Intronic
989254517 5:39351813-39351835 GGTCTCAGAAGAAGACAGGAAGG - Intronic
989527050 5:42465794-42465816 GGTCTTGGAAGAGGTCGAGAGGG - Intronic
990331340 5:54729203-54729225 GTTCTGAGGAGAGAGCAAGAAGG + Intergenic
991234781 5:64380858-64380880 GGGCAGAGAAGATCACAAGAAGG + Intergenic
991390382 5:66136835-66136857 GGCCTCAGAAGAAGATAAGAAGG - Intergenic
992581483 5:78182833-78182855 GGTTTCAGAAAAGGCCAAGATGG + Intronic
992606862 5:78466444-78466466 GGACAGGGAAGAGGATAAGAGGG + Intronic
992886850 5:81167966-81167988 GATCTGAGAAGAGGGGAAGGCGG - Intronic
993247418 5:85468301-85468323 TATCTGTGCAGAGGACAAGAAGG + Intergenic
993466197 5:88249888-88249910 GGACACAGAAGAAGACAAGAGGG + Intronic
994331487 5:98511752-98511774 GGTCTGAGAGCATGACAAGTGGG - Intergenic
994651914 5:102539698-102539720 TGTCTGAGGACAGGAGAAGATGG - Intergenic
995078505 5:108016706-108016728 GGATTAAGAAGAAGACAAGAAGG - Intronic
997351959 5:133237185-133237207 GGACGGAGAAGGGGACAAGTGGG - Intronic
997891813 5:137683588-137683610 CTTCTGAGAAGAGGTCAAGGTGG - Intronic
998254391 5:140573673-140573695 GCTTTGGAAAGAGGACAAGAAGG + Intronic
998351901 5:141507563-141507585 GGTCTGAGGAGATGCCAAGTTGG + Intronic
999367989 5:151035267-151035289 GGTCTGTGCACAGGTCAAGAGGG + Intronic
999586128 5:153091383-153091405 GGTCTGGGAAGAGGAAAGGGAGG + Intergenic
1001314778 5:170634138-170634160 GGTCTGAGCAGATAACCAGATGG + Intronic
1001475630 5:172048757-172048779 GTTCTGAGCAGAGGACAAGGTGG - Intronic
1001716104 5:173817754-173817776 GGGCTGAGAAGAGGGGAGGAAGG + Intergenic
1001746807 5:174098609-174098631 GGTCTGAACAGAGCACACGAGGG - Intronic
1001896788 5:175389166-175389188 GGGATGAGAAAAGGACAAAACGG + Intergenic
1001912355 5:175531494-175531516 TTTCTGAGAAGAGGGCTAGAGGG + Intergenic
1003820409 6:9890120-9890142 TGTCTGAGAGCAGGAAAAGATGG - Intronic
1005097780 6:22136840-22136862 GGTGGGAGAAGAGAAAAAGAAGG + Intergenic
1005524625 6:26633830-26633852 ATTGTGAGAAGAGGATAAGAAGG - Intergenic
1006067772 6:31474803-31474825 GGTCACTGCAGAGGACAAGAAGG - Intergenic
1006336134 6:33421329-33421351 GCTATGAGAAGGGGTCAAGACGG - Intronic
1006915538 6:37591521-37591543 GGGCTGAGGACAGGACTAGAGGG + Intergenic
1007071865 6:39043821-39043843 GGTCTGAGAAGAGAAGCAGGAGG + Intergenic
1007482718 6:42160669-42160691 AGGCACAGAAGAGGACAAGATGG + Intronic
1007714607 6:43848501-43848523 GGTCTCAGAGGAGGCCAAGCTGG - Intergenic
1008200187 6:48577545-48577567 TGTTTGAGAAGTGAACAAGAAGG + Intergenic
1008505239 6:52223870-52223892 GGTCTCAGAGGAGACCAAGATGG - Intergenic
1010404014 6:75482063-75482085 GCTCAGAGAAGAGGACAAGGGGG - Intronic
1011335851 6:86259094-86259116 GGTCTGAGAAGAAAATAACAGGG - Intergenic
1011553703 6:88552669-88552691 GGTCAGAGAAGACGTCAAGCAGG - Intergenic
1012210797 6:96516575-96516597 TGTCCGAGAGGAGGAGAAGATGG - Intergenic
1012451892 6:99361600-99361622 TGGCTGAAAAGAGGACATGATGG - Intergenic
1012586960 6:100935044-100935066 GGGCTGAGCAGAGGAAGAGAAGG - Intergenic
1013812807 6:114063793-114063815 GGACTGAGCAGAGGACATGGAGG - Intronic
1015652418 6:135478242-135478264 GGGCTCAGAAGAAGACAGGAAGG + Intronic
1015824659 6:137298778-137298800 AGTATGATTAGAGGACAAGATGG - Intergenic
1015845403 6:137515383-137515405 GGCCTGAGAGGAGGTGAAGAAGG - Intergenic
1015931015 6:138359911-138359933 TGTTTGAGAAGGGGACAGGATGG + Intergenic
1016134236 6:140519404-140519426 GGTCTGAGAAGAGGGGAAATGGG + Intergenic
1016747764 6:147599201-147599223 GGGTTGAGAAGTGGATAAGAAGG + Intronic
1017896675 6:158686094-158686116 GTGCTGAAAAGATGACAAGATGG - Intronic
1018021126 6:159762750-159762772 GGTCTGAGCAAAGGTCAAGGTGG - Intronic
1020979892 7:15054046-15054068 GGGCTAAGAAGAGGACAAAAAGG - Intergenic
1022705276 7:32796183-32796205 GGTTTGTGAAGGGGAGAAGAGGG - Intergenic
1022974854 7:35547668-35547690 GGGTTAAGGAGAGGACAAGAGGG + Intergenic
1023178959 7:37461833-37461855 AGTCTGAGAAGAACAAAAGAAGG - Intergenic
1023689711 7:42773170-42773192 CGTCTGCGAAGAGGAGAGGAGGG - Intergenic
1023762494 7:43479554-43479576 GGTGTGAGAATAGGCCAAAATGG - Intronic
1023852458 7:44158023-44158045 GGGCTGAGGAGAGGAACAGAAGG + Intronic
1024229602 7:47354277-47354299 GAGCTGATAAGGGGACAAGAGGG + Intronic
1025164427 7:56699497-56699519 GGGCTCAGAAGTGGAGAAGATGG + Intergenic
1025705846 7:63862575-63862597 GGGCTCAGAAGTGGAGAAGATGG - Intergenic
1026228482 7:68463022-68463044 GGAGAGAGAAGAGGAGAAGAGGG - Intergenic
1027224895 7:76237654-76237676 AGTGTGGGCAGAGGACAAGAGGG + Intronic
1027498395 7:78917434-78917456 GGACTGTGAAGAGGAATAGATGG + Intronic
1030122910 7:106128096-106128118 GGCCTGAGAAGAAGAAAACAGGG + Intergenic
1030150396 7:106398707-106398729 TGTCTGTGAAGAAGACATGATGG + Intergenic
1032037123 7:128529792-128529814 GGTAGGAAAAGAGGGCAAGATGG - Intergenic
1032143903 7:129361005-129361027 GCTCTGAGATGATGACAATATGG - Intronic
1032269167 7:130388028-130388050 GGCCAGAGAGGAGGACAAGAAGG - Exonic
1032684308 7:134215834-134215856 ATTCAGAGAAGAGGATAAGAAGG + Intronic
1033360800 7:140637763-140637785 GGTCTGAGAAGGGGACAGGTAGG - Intronic
1036191636 8:6676299-6676321 GGTGTGAGAAGCAGACAGGATGG + Intergenic
1037563118 8:20092549-20092571 GGTCAGAGAGGAGAACAAGAGGG - Intergenic
1037712351 8:21364912-21364934 TGTCTGAGAAGCGGAAAACAAGG + Intergenic
1037911900 8:22748599-22748621 GGTCTGAGGGGAGAACAAGGAGG + Intronic
1038056830 8:23866673-23866695 TGTCTGAGAACTGGACAAGGAGG - Intergenic
1038451100 8:27639451-27639473 GGTCAGTGAAGAGGGCAGGAAGG + Intronic
1039873424 8:41566492-41566514 GGTCTGTGATCAGGACAGGAGGG - Intergenic
1040078772 8:43267013-43267035 GGGCTCAGAAGAAGACAGGAGGG - Intergenic
1041896360 8:62929019-62929041 TCTCTGAGAAGAGGACATGTAGG + Intronic
1043533734 8:81177285-81177307 AGACTCAGAAGAAGACAAGAAGG - Intergenic
1043656954 8:82679665-82679687 GGTGAGGGAAGAGGAGAAGAAGG + Intergenic
1043992606 8:86774471-86774493 GGTCTGAGAAAAGGGGTAGATGG - Intergenic
1044725393 8:95190708-95190730 GGTGTGAGGAGAGCTCAAGAGGG - Intergenic
1045436787 8:102171978-102172000 GATCTGAGAAAGGGACAAAAGGG + Intergenic
1045511740 8:102816870-102816892 GGTTTGGGAAGAGGAGAAAAGGG + Intergenic
1045863742 8:106841389-106841411 TGTCTGAGGGTAGGACAAGATGG + Intergenic
1046060270 8:109131007-109131029 AGGCTGAGAAGAGGAAGAGAGGG - Intergenic
1046634029 8:116652097-116652119 GGACAGAGATGAGCACAAGAGGG + Intronic
1047432971 8:124808613-124808635 GGCTTGAGAAGAGGACAGGATGG - Intergenic
1048444367 8:134482153-134482175 GGTCAGAGAAGAAGTCAAGGTGG - Intronic
1049311583 8:141936498-141936520 GGTCTGAGCAGAGAGCAAGGTGG + Intergenic
1049887361 9:36596-36618 TGGCTGAGATGAGGACAGGAGGG + Intergenic
1050711957 9:8475256-8475278 GGTCTGCTAAGAGGGCAAGAAGG - Intronic
1051088128 9:13375868-13375890 GGGCTGGAAAGAGGAGAAGAAGG + Intergenic
1051112835 9:13659278-13659300 GTTTTGAGCAGAGGATAAGAGGG + Intergenic
1052540836 9:29810026-29810048 GGGCTCAGAAGAAGACAGGAAGG + Intergenic
1053113762 9:35484347-35484369 GGCCTGAGGAGAGGTAAAGATGG + Intergenic
1053515066 9:38723493-38723515 TGCCTGAGAAGAGGACAGGAGGG - Intergenic
1055364252 9:75526678-75526700 GGCCTGAGAAGGAGACAAAAAGG - Intergenic
1056299869 9:85229859-85229881 GGACTGAGAAGTGGAGGAGAAGG - Intergenic
1056768983 9:89463400-89463422 TGTCTACGAAGAGGACCAGATGG - Intronic
1057834632 9:98434452-98434474 GGTCTCTGAAGGGGAGAAGAAGG + Intronic
1058857815 9:109083003-109083025 TAGCTGAGAACAGGACAAGAAGG + Intronic
1059452782 9:114381240-114381262 GGCCTGGGCCGAGGACAAGAGGG - Exonic
1059761515 9:117342184-117342206 GGTCTGTGAATAGGACAATCAGG + Intronic
1060028056 9:120189874-120189896 GGTCTGGGTAGAGAACAAGGAGG + Intergenic
1061443456 9:130623258-130623280 GGTCTGAAAAGAGGAAAACATGG + Intronic
1061465151 9:130772570-130772592 GGTGGGAGAAGAGGAGGAGACGG + Intronic
1062438672 9:136558903-136558925 GGGCTCAGAAGAAGACAGGAAGG + Intergenic
1203545460 Un_KI270743v1:125044-125066 GGTCTTGGAAGAAGACAGGAAGG - Intergenic
1185668682 X:1788355-1788377 GCTCTGAGAAGAGAAGAAGTGGG - Intergenic
1186487350 X:9943671-9943693 GCTCTGAAAAGTGGTCAAGATGG + Intronic
1187987420 X:24829398-24829420 GATGAGAGAAGAGGACAAGCAGG - Intronic
1188973623 X:36647228-36647250 GGTGTGAAAATAGGACAAGGAGG - Intergenic
1189008386 X:37018963-37018985 GGGGTGAGGAGAGGACAAGGAGG - Intergenic
1189040341 X:37536047-37536069 GGGGTGAGGAGAGGACAAGGAGG + Intronic
1189376007 X:40466841-40466863 GAAATGAGAAGAGGACAAGAAGG + Intergenic
1189682500 X:43531360-43531382 GGACTGAGAGCAGGACAAGTGGG - Intergenic
1189886293 X:45547798-45547820 GGGCTCAGAAGAAGACAGGAAGG - Intergenic
1190049964 X:47142243-47142265 GCTCTGAGAAGAGGTCAGAATGG + Exonic
1190129669 X:47735389-47735411 TGTCTGAGAGCAGGAGAAGATGG + Intergenic
1192369726 X:70503448-70503470 GGGCTGAGAGGAGGACACGGAGG + Exonic
1193974176 X:88097242-88097264 GGTCTTAGAACAGCCCAAGATGG - Intergenic
1195217684 X:102716171-102716193 GGCCAGAGAAGAGGCCAAGCCGG + Exonic
1196129099 X:112133496-112133518 GGTATGAGAGAAGGATAAGAAGG - Intergenic
1198509957 X:137340587-137340609 TGTCTGTGAAGAGGGGAAGAGGG + Intergenic
1198510097 X:137341766-137341788 TGTCTGTGAAGAGGGGAAGAGGG - Intergenic
1198890396 X:141388614-141388636 TGACTTAGGAGAGGACAAGAAGG + Intergenic
1199256792 X:145726548-145726570 GGGTTTAGAAGAGGACAACATGG + Intergenic
1199772859 X:150984804-150984826 GGTGTGGGAAAAGGAAAAGATGG + Intronic
1199914294 X:152322322-152322344 GGGCTGAGAAGAGGAGAAACAGG + Intronic
1200751096 Y:6945023-6945045 GGTCTTAGAAAAGGAAAAAAAGG - Intronic
1200955258 Y:8938214-8938236 GGTCAGAGCAGAGGCCAAGGTGG - Intergenic
1201937235 Y:19421823-19421845 GATATGAGAAGAGGACACAAAGG - Intergenic
1201963522 Y:19707630-19707652 AGTCGGAGAAGAGGCCATGAGGG + Exonic
1202052833 Y:20798474-20798496 GGTCTGAGCAGAGGCCAACTCGG - Intergenic