ID: 1087660851

View in Genome Browser
Species Human (GRCh38)
Location 11:100986394-100986416
Sequence CATTGTGACTGGAGTAGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 2, 2: 2, 3: 47, 4: 318}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087660845_1087660851 24 Left 1087660845 11:100986347-100986369 CCTGAGGTGGGAATGAATTTGGC 0: 1
1: 2
2: 17
3: 80
4: 328
Right 1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG 0: 1
1: 2
2: 2
3: 47
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087660851 Original CRISPR CATTGTGACTGGAGTAGAGT AGG Intronic
902242595 1:15098977-15098999 CAATGTGACTGGTGCAGAGATGG + Intronic
902663741 1:17923181-17923203 CATTGTGCCTGGCATATAGTAGG - Intergenic
902706190 1:18206650-18206672 CAATGTAGCTGGAGCAGAGTGGG + Intronic
903293504 1:22329303-22329325 CTGAGTGGCTGGAGTAGAGTGGG - Intergenic
903320560 1:22540658-22540680 CAGGGTGGCTGGAGCAGAGTGGG + Intergenic
903456706 1:23492447-23492469 CAATGTGACTGGAGCAGGGGAGG - Intergenic
904929406 1:34074414-34074436 CATTTTGGCTGGTGTATAGTGGG - Intronic
906656513 1:47552284-47552306 CCTTGTGGCTGGAGCACAGTGGG - Intergenic
906747544 1:48232254-48232276 GATTGTGACTGGACTGGAGTAGG + Intronic
906894926 1:49760473-49760495 CATTATGACTGGTGTTGAGATGG - Intronic
906949670 1:50323999-50324021 TATTGGGAGTGGAATAGAGTGGG - Intergenic
908389924 1:63675197-63675219 CACTGTGCCTGGAGCATAGTGGG + Intergenic
909180164 1:72413761-72413783 CATGGTGGCTGGACTATAGTGGG + Intergenic
909761844 1:79298155-79298177 CAGTGTGTCTAGAGTAGAGGTGG + Intergenic
911559236 1:99383717-99383739 GATGATGACTGGAGCAGAGTAGG + Intergenic
911869821 1:103082423-103082445 CATCGTGACTGGGGTATAGGAGG - Intronic
911888092 1:103329223-103329245 CATGTAGACTGGAGTAGAATGGG - Intergenic
912079510 1:105917577-105917599 CATTTTGACTAGAGTAGTCTCGG + Intergenic
914256666 1:145965565-145965587 CATTGTGTCTGGCATATAGTAGG - Intronic
914697772 1:150101406-150101428 CATTCTGACTGGTGTTGAGATGG - Intronic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915176403 1:154018998-154019020 CATTGTCACTGGAGTAGGAGTGG - Exonic
915578464 1:156797517-156797539 CATTGAGACTGAAGTAGAGCAGG - Intronic
915704434 1:157830488-157830510 CAGTGGGACAGGAGGAGAGTGGG - Intergenic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
916911663 1:169355534-169355556 CAGTGTAACTGGAGCAGAGAAGG - Intronic
917021402 1:170592298-170592320 CATTGTGACTGAACTAGAGAGGG + Intergenic
917218441 1:172702265-172702287 CAGTTTGTCTGGAGTGGAGTGGG + Intergenic
918124769 1:181573589-181573611 CATTCTGACTGGTGTTGAGATGG - Intronic
918184242 1:182113196-182113218 CATTGTGACTTTATAAGAGTGGG + Intergenic
918877702 1:190070872-190070894 CATTCTGACTGGCGTTGAGATGG + Intergenic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
921780121 1:219153091-219153113 AATTGTGACTGGAGTGTAGAGGG - Intergenic
923054279 1:230413872-230413894 CATAGTGCCTGGTGCAGAGTAGG + Intronic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
923880436 1:238098347-238098369 TATTCAGACTGGAGTAGTGTTGG + Intergenic
1064813909 10:19234697-19234719 CATAGTGTCTGGAGTATAGTAGG - Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067743557 10:48915066-48915088 GATTGTGAGTAGAGTAGAGCTGG - Intronic
1068799009 10:61118274-61118296 GATTGTGAATGGAGTAGAGGTGG - Intergenic
1072064917 10:91858560-91858582 CCTTGGGAGTGGAGTAGAGTGGG - Intronic
1073665123 10:105523087-105523109 CATTGTGACTGGAGTTTCATAGG + Intergenic
1073788449 10:106915558-106915580 CAATGTGACTAGAGTAGAGTGGG - Intronic
1075960407 10:126563208-126563230 CATTGGCACTGCAGTAGCGTGGG + Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077603016 11:3586908-3586930 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1077953490 11:6988334-6988356 ATTTGTGTCTGGATTAGAGTAGG + Intergenic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1078476901 11:11638181-11638203 CACTGTGCTTGGAGCAGAGTGGG + Intergenic
1078576016 11:12503405-12503427 TATGGTGATTGGAGTGGAGTGGG + Intronic
1079466278 11:20734174-20734196 CATGGTGACTAAAGTAGAGAAGG + Intronic
1079934729 11:26602708-26602730 CATTCAGGCTGGAGTACAGTGGG - Intronic
1081427251 11:42938846-42938868 CAATGTGGCTAGAGCAGAGTTGG - Intergenic
1081438940 11:43058857-43058879 AATTGTGCCTGGAGCACAGTGGG + Intergenic
1083890723 11:65594497-65594519 CATCCTGACTGGAGCAGAATGGG - Intronic
1084258896 11:67961446-67961468 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1084813851 11:71633732-71633754 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1085645595 11:78220300-78220322 CAAGGTGCCTGGAGTAGAGTTGG - Exonic
1087521186 11:99238900-99238922 CATTGTGACTGAAGAAAATTTGG + Intronic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1087825035 11:102755367-102755389 CAATGTGGCTGGAGCAGAGTGGG + Intergenic
1087843249 11:102941928-102941950 AATTGAGACTGGAGTAAAGGTGG + Intergenic
1089466844 11:118691005-118691027 CTGTGTGACTGGGGCAGAGTGGG - Intergenic
1092430222 12:8402454-8402476 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1093008038 12:14072240-14072262 CATAGTGCCTGGCATAGAGTAGG - Intergenic
1093684396 12:22039893-22039915 CATTAAGGCTGGAGTAGGGTAGG - Intergenic
1094084385 12:26573761-26573783 CAGTGTGGATGGAGCAGAGTTGG + Intronic
1094254615 12:28408478-28408500 CATTCTGACTGGCGTTGAGATGG + Intronic
1094554288 12:31482996-31483018 CATTGTTGCTGGAGCAGAGTGGG - Intronic
1095991704 12:48039233-48039255 CATTGTGGCTGAGGCAGAGTGGG + Intergenic
1098241130 12:68468186-68468208 AACTGTGACTTCAGTAGAGTAGG - Intergenic
1098270201 12:68762510-68762532 CATTCTGCCTGGAGTAAAGTGGG + Intronic
1098589785 12:72197273-72197295 CATTTTAAATGGAGTAGAATGGG - Intronic
1099220840 12:79912023-79912045 CAGTGTGACTGGAGCACAGGGGG - Intronic
1099711785 12:86235852-86235874 CATAGTGATTGGAATAAAGTTGG + Intronic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102200947 12:111057359-111057381 CTATGTGAGTGGAGTGGAGTGGG + Intronic
1102222416 12:111203587-111203609 CCATGTGCCTGGAGCAGAGTGGG + Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1102704715 12:114870949-114870971 CATAGTGAGTGGAGAAGAGAAGG - Intergenic
1102926244 12:116828601-116828623 CATTGTGTCTGGTGCATAGTAGG + Intronic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1106713186 13:32360218-32360240 TAGTGCAACTGGAGTAGAGTGGG + Intronic
1109864687 13:68247259-68247281 CATTCTGACTGGTGTGAAGTGGG + Intergenic
1110362415 13:74642661-74642683 CTTTGTTAGTGGAGTGGAGTGGG + Intergenic
1110465895 13:75801001-75801023 CATAGAGACTGGAGTATAATTGG + Intronic
1110619555 13:77579731-77579753 CGTTGTATCTGGAGTAGAGTAGG + Intronic
1111454442 13:88461981-88462003 CAATGAGACTGGAATAGGGTAGG - Intergenic
1111983593 13:95042374-95042396 CATTGTGCATGGTGTAGAGAGGG + Intronic
1112118330 13:96382159-96382181 CCTTGTCAATGGAGCAGAGTGGG + Intronic
1112378708 13:98868142-98868164 CAGGGTGACTAGAATAGAGTAGG - Intronic
1117359571 14:54959736-54959758 CACTCAGACTGGAGCAGAGTTGG - Intronic
1118252089 14:64171677-64171699 CAGTGTGACTGGCGCAGAGCTGG + Intronic
1119197676 14:72729400-72729422 TCTTGTGCCTGGAGTGGAGTGGG + Intronic
1121032076 14:90666796-90666818 CACAGTGAGAGGAGTAGAGTGGG + Intronic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1121482907 14:94292156-94292178 CATTGTGATGGCAATAGAGTTGG + Intronic
1124318274 15:28691857-28691879 CACTGAGGCTGGAGTACAGTGGG - Intergenic
1124565166 15:30805600-30805622 CACTGAGGCTGGAGTACAGTGGG + Intergenic
1125034988 15:35112898-35112920 CATTATCAGTGTAGTAGAGTTGG + Intergenic
1125981276 15:44003541-44003563 TATTGTGTTTGGAGTAAAGTAGG - Intronic
1126360285 15:47838466-47838488 CGTTTTGCCTGAAGTAGAGTTGG + Intergenic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1127864195 15:63018558-63018580 CATTGTGCCTGGCACAGAGTAGG + Intergenic
1128306177 15:66600317-66600339 CATTGTGACAGGTGTGCAGTGGG + Intronic
1128506489 15:68276814-68276836 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1129334866 15:74845780-74845802 CCTTGTGAATGGGGTAGTGTGGG - Intronic
1131308693 15:91268426-91268448 CATAGTAACTGGAGTGGAGAAGG - Exonic
1131564570 15:93474339-93474361 CATTTTGAATTGAGCAGAGTTGG - Intergenic
1131755248 15:95553076-95553098 CGCTGTGTCTGGAGTATAGTGGG - Intergenic
1132265913 15:100470515-100470537 CAGAGTGACTGTAGTGGAGTGGG + Intronic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133772938 16:8878248-8878270 CAATGTGGCTGGAGTAGGGAGGG + Intergenic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1138197210 16:55060501-55060523 CCATGTGGCTGGAGCAGAGTGGG - Intergenic
1139084338 16:63565959-63565981 CATTGTGCCTGACATAGAGTAGG - Intergenic
1140055493 16:71522027-71522049 AATTGTCCCAGGAGTAGAGTTGG - Intronic
1140656319 16:77143701-77143723 CCTTGTGCCTAGGGTAGAGTTGG - Intergenic
1140705292 16:77623190-77623212 CATTCTGGCTGGGGTAAAGTTGG + Intergenic
1141525554 16:84608932-84608954 CATTGTTTCTGGAGCAAAGTAGG + Intronic
1142481091 17:218678-218700 CATTGAGACTGGTATAGAGAAGG - Intronic
1142490842 17:278430-278452 CAGTGTGACTTGAGTTAAGTTGG - Intronic
1144330842 17:14222802-14222824 CACTGTGGCTGGAGCAGTGTGGG - Intergenic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1144743861 17:17600125-17600147 CACTGTTGCTTGAGTAGAGTTGG + Intergenic
1146582947 17:34055918-34055940 CATTGGGAATAGAGTAGAGGGGG + Intronic
1149694453 17:58605601-58605623 CCCTGTGACTTGAGTGGAGTGGG - Intronic
1151487554 17:74410744-74410766 CAGGGTGGCTGGGGTAGAGTGGG + Intergenic
1151499493 17:74479943-74479965 CATTGTGACTGGGGTAGACTGGG + Intronic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152622263 17:81371046-81371068 AAGTCAGACTGGAGTAGAGTGGG + Intergenic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1155056515 18:22188501-22188523 CATTGTGACTGGAGTGTAGGGGG + Intronic
1155503150 18:26506677-26506699 CCTTGTGTCTGGAGAAGAGGAGG + Intronic
1158253439 18:55516782-55516804 GAGTGTGGCTGGTGTAGAGTGGG + Intronic
1158997178 18:62934029-62934051 CATTCTGACTGGTGTTGAGATGG - Intronic
1159065008 18:63559928-63559950 CATTGTGGGTGGAATAGAGTGGG + Intronic
1160044747 18:75376354-75376376 GTTTGTGATTGGAGCAGAGTAGG + Intergenic
1160296860 18:77646521-77646543 TGTTGTGGCTGGAGTCGAGTGGG + Intergenic
1161638813 19:5406803-5406825 CAGTGTGGCTGGAGCAGAATGGG - Intergenic
1162087845 19:8259362-8259384 CTGTGTGGCTGGAGCAGAGTGGG + Intronic
1163423864 19:17230152-17230174 CAGTTTGACTGGAGTAGACATGG + Intergenic
1165387220 19:35517630-35517652 CATTGTGGCTGGAGCAGTGTTGG + Intergenic
1165394151 19:35555166-35555188 CATTGTGACAGGCGTGGAGCAGG - Exonic
1165891235 19:39113502-39113524 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1165984467 19:39755925-39755947 CACTGTGTCTGGAGTAGAGGGGG - Intergenic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166298718 19:41902426-41902448 CCCTGGGACTGGAGTAGGGTGGG - Intronic
1166729375 19:45050121-45050143 CTGTGTGCCTGGAGCAGAGTAGG + Intronic
1166840807 19:45695815-45695837 CTCTGTGCGTGGAGTAGAGTGGG - Intronic
1167702785 19:51060362-51060384 GATTGTGGATGGGGTAGAGTTGG - Intronic
1167763853 19:51466790-51466812 CATAGTAAATGGAGTAGTGTAGG + Intergenic
1167958505 19:53087207-53087229 CTGTGTGACTGGAGCAGAGGGGG + Intronic
1168018827 19:53594464-53594486 CATTGGGACTGGAATGGAGGTGG + Intergenic
1168269002 19:55239647-55239669 CATCGTCACTGGAGGAGTGTAGG + Exonic
1168411355 19:56142057-56142079 CATCCTGACTGGGGTAGAGGTGG - Intronic
1168515129 19:57004513-57004535 CATTGTGTCTGCAGTAGATGTGG + Intergenic
926371671 2:12184944-12184966 CAATTTGACTGCAGTGGAGTGGG + Intergenic
926796531 2:16624062-16624084 CATTGTGACTAGTGGAGAATAGG - Intronic
927455627 2:23246885-23246907 CATTGGGGCTGGAGTAGGGGTGG - Intergenic
930369174 2:50482276-50482298 CACTGTTACTGGCATAGAGTGGG - Intronic
930889035 2:56361666-56361688 CAATGTGGCTGGAACAGAGTGGG + Intronic
932985272 2:76719001-76719023 CATGTTTCCTGGAGTAGAGTAGG + Intergenic
933005347 2:76985881-76985903 GAATGTTAGTGGAGTAGAGTGGG - Intronic
933183921 2:79258053-79258075 CATTAATACTGGAGTAGTGTGGG - Intronic
933699454 2:85244148-85244170 CAGAGTGGCTGGAGCAGAGTGGG + Intronic
934024609 2:87990705-87990727 CATCTAGACTGGAGTAAAGTGGG - Intergenic
934767202 2:96886299-96886321 CAATGTGACTGGCTTAGAGACGG + Intronic
935167311 2:100580726-100580748 CATTGCCACTGGAGTAGAGGGGG - Intergenic
937466169 2:122134967-122134989 CATAGTGGCTGGAGCTGAGTGGG + Intergenic
938933652 2:136109588-136109610 CACTGTGCCTGGCGTATAGTAGG - Intergenic
939956586 2:148532516-148532538 CATGGTGCCTGGACTGGAGTAGG - Intergenic
943192616 2:184698900-184698922 CATTTTGAATGGATTAGAATTGG + Intronic
943713346 2:191122840-191122862 CTTTGTGACTGGTGTTGACTAGG + Intronic
944486996 2:200217426-200217448 CTGTGTGCCTGGAGTAGAGGTGG - Intergenic
945221727 2:207490457-207490479 CATTGTGAAGGGAGTGGAGAGGG + Intergenic
946411356 2:219516828-219516850 CATTGTGCAGGGAGAAGAGTCGG + Intronic
947269036 2:228313010-228313032 AATTATGACTGGAATAGTGTTGG - Intergenic
947275101 2:228381894-228381916 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
948278008 2:236724900-236724922 CAATGAGACTGGAGAAGAATGGG + Intergenic
1168962796 20:1880463-1880485 CAGTGTGGCTGAAGCAGAGTGGG + Intergenic
1169275336 20:4229970-4229992 CAATGTGGCTGGAACAGAGTAGG - Intronic
1170372293 20:15662413-15662435 CATTGTGACTGGCACATAGTAGG + Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1173467166 20:43292405-43292427 CATTGTGATTGGCTTGGAGTAGG - Intergenic
1173919063 20:46730433-46730455 GGTTGTGGCTGAAGTAGAGTGGG + Intronic
1173970524 20:47148802-47148824 CAGAGTGAGTGCAGTAGAGTGGG - Intronic
1174201995 20:48813075-48813097 CGTTGGGGGTGGAGTAGAGTAGG - Intronic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174308524 20:49632236-49632258 CAGCGTGGCTGGAGTAGAGGGGG - Intergenic
1174392297 20:50225194-50225216 CCATGTGGCTGGAGTAGAATGGG + Intergenic
1175072809 20:56348703-56348725 CATTGTGCCTGGCATTGAGTAGG + Intergenic
1176983314 21:15407875-15407897 CATTGTGATTAGGGTAGACTGGG - Intergenic
1178509686 21:33193946-33193968 CATTGTGAATGGATCACAGTGGG - Intergenic
1181153635 22:20903154-20903176 CATTGTGCCTGGCACAGAGTAGG + Intergenic
1181558107 22:23683741-23683763 CACTGTGACTGCAGTCCAGTGGG + Intergenic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1183786656 22:40032931-40032953 CATGGTGACTGGCATATAGTAGG - Exonic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1185172189 22:49300489-49300511 CCTTGTGACTGGAGCAGGCTGGG + Intergenic
949410185 3:3755045-3755067 CATTTTGCCTGGACTAGAGTTGG + Intronic
949571365 3:5296481-5296503 CATTATGAGTGAACTAGAGTTGG - Intergenic
949859128 3:8489643-8489665 CATTGTGACAGGAAAAGAATGGG - Intergenic
950935306 3:16833503-16833525 AATTGAGAATGGAGTTGAGTGGG - Intronic
951992027 3:28685663-28685685 CATGGTGACTGGAGAACATTTGG + Intergenic
952739065 3:36717915-36717937 CACTGTGCCTGGTGCAGAGTTGG - Intronic
953399761 3:42602465-42602487 CAGTGTGGCTGGAGTAGAAGAGG + Intronic
954758043 3:52853017-52853039 CATTGTGAGTGAAGTTGAATGGG - Intronic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
960444896 3:117735855-117735877 CAGTGTGACTGGACTAGAATGGG - Intergenic
960459378 3:117914430-117914452 CTTAGTGACTGGAGAAGAATGGG + Intergenic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
961280237 3:125760754-125760776 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
961686521 3:128636418-128636440 CATTCAGACTGGAGTGCAGTGGG - Intronic
961723647 3:128911838-128911860 CATTTTGGATGGAGTACAGTGGG - Intronic
961874169 3:130008793-130008815 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
962350048 3:134650070-134650092 CAATGTGAATGGAGTACAGAGGG - Intronic
962849392 3:139296648-139296670 CATTCTGACCAGAGCAGAGTGGG - Intronic
963461537 3:145620001-145620023 TAGTGTGACTGAAGTATAGTGGG + Intergenic
963948876 3:151176953-151176975 CACGGTGCCTGGTGTAGAGTAGG - Intronic
965449978 3:168825754-168825776 CATTGTCAATGGAGTAGAGAAGG - Intergenic
965666491 3:171099495-171099517 CATGGTGTCTGGAATACAGTGGG - Intronic
965677851 3:171217593-171217615 AATTATGACTGGAATATAGTAGG - Intronic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
967852997 3:194096099-194096121 CACAGTGACTGGAATATAGTAGG - Intergenic
968494327 4:907097-907119 CATTGTCAGTGGAATTGAGTCGG - Intronic
968598995 4:1500377-1500399 CACTGGGACTGGGGCAGAGTAGG + Intergenic
969008434 4:4040699-4040721 CATAGTGGCTGAAATAGAGTAGG - Intergenic
969736512 4:8995029-8995051 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
969745245 4:9065681-9065703 CATAGTGGCTGAAATAGAGTAGG + Intergenic
970457034 4:16234601-16234623 CATTTTGACTTGAGGAGAGTGGG + Intergenic
970653263 4:18201340-18201362 GATAGTGCCTGGAATAGAGTAGG + Intergenic
971527222 4:27635795-27635817 CACTGTGACTGCAGTAGGGATGG - Intergenic
973832616 4:54776916-54776938 GAGTGTGGCTGGAATAGAGTGGG + Intergenic
974793834 4:66722956-66722978 AATTTTGACTGGAGAAGTGTAGG - Intergenic
975293949 4:72710381-72710403 CATTTTTACTGGATAAGAGTTGG - Intergenic
975768546 4:77695951-77695973 CATTCTGTCTGGAGTAGGGAAGG - Intergenic
975845193 4:78517698-78517720 CAGTGTGCCTGGTGTAGAATAGG + Intronic
976497290 4:85744983-85745005 CATTGAGACTGGATTAAAGAAGG - Intronic
978723447 4:111942171-111942193 CCTTGTGAATGGATTAGAGTGGG - Intergenic
980692015 4:136307351-136307373 CACTGTGACTGGCCTAAAGTAGG + Intergenic
980853334 4:138410472-138410494 CAGAGTGACTGGAGCAGTGTGGG - Intergenic
981048311 4:140286247-140286269 AATTGTGGCTGGCATAGAGTAGG + Intronic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981624638 4:146741801-146741823 AGTTGTGACGGGAGTAGAGTAGG - Intronic
984930122 4:184839600-184839622 AAGTGTGACTGCAGGAGAGTTGG - Intergenic
985164778 4:187081859-187081881 CAATGTGCCTGGAGTCAAGTAGG - Intergenic
986475137 5:8121960-8121982 CATAGTGCTTGGAGTAGAATAGG + Intergenic
986557461 5:9025845-9025867 GAATTTGACTGGAGTGGAGTAGG - Intergenic
987231456 5:15897864-15897886 CAATGGGAATGGACTAGAGTTGG + Intronic
987269378 5:16290386-16290408 CATTGTGGCAGGAGCAGAGGGGG + Intergenic
990399455 5:55423464-55423486 CAGTGTGGCTGGAGCAGAATGGG + Intronic
991251220 5:64563415-64563437 AAATCTTACTGGAGTAGAGTGGG + Intronic
991442298 5:66663661-66663683 CACTGTAGCTGGAATAGAGTGGG + Intronic
991772589 5:70053586-70053608 AATTATGACAGGAGTAGTGTTGG + Intronic
991851882 5:70929010-70929032 AATTATGACAGGAGTAGTGTTGG + Intronic
993536171 5:89088812-89088834 CATTTTGAGGGGAGTGGAGTAGG + Intergenic
995198288 5:109398105-109398127 CATTCTGACTGGTGTGGAGATGG - Intronic
996008488 5:118452704-118452726 CAGTGTCACTGGAATAGAGCTGG + Intergenic
997881917 5:137599369-137599391 CATAGAGACTGGTGTACAGTAGG - Intergenic
998250994 5:140552315-140552337 CATATTGTCTGGCGTAGAGTGGG - Intronic
998669489 5:144337796-144337818 CATAGTGAAGGGAGAAGAGTGGG + Intronic
998921336 5:147071506-147071528 CAGTGTGTCTGAAGTTGAGTAGG - Intronic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
999970836 5:156860760-156860782 GATGGTGGCTGGAGGAGAGTCGG - Intergenic
1000102779 5:158032728-158032750 TTTTGTGACTGTTGTAGAGTAGG + Intergenic
1000380114 5:160621344-160621366 CAGTGTGTAGGGAGTAGAGTTGG + Intronic
1000643405 5:163732544-163732566 CCTTGTTACTGGAGTGAAGTTGG + Intergenic
1001961647 5:175883497-175883519 CCTTGTGGCTAGAGTACAGTGGG + Exonic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1003078790 6:3004443-3004465 CATTGTGGCTGAAGCTGAGTTGG - Intronic
1003257256 6:4485308-4485330 CACTGTGGCTGGGGCAGAGTGGG - Intergenic
1003708472 6:8562107-8562129 CCATGTGGCTGGAGTAGAGGAGG - Intergenic
1004755032 6:18601710-18601732 CACTGTGACAGGAGCAGTGTGGG + Intergenic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1005001453 6:21245968-21245990 CATTTTCACTGAAGTAGGGTTGG + Intergenic
1005548241 6:26890703-26890725 CATTCTGACTGGTGTTGAGATGG - Intergenic
1006811117 6:36821237-36821259 CCGTGTGACTGGAGTGGAGTGGG + Intronic
1008883848 6:56410709-56410731 TGTTATGACTGGGGTAGAGTTGG - Intergenic
1009814246 6:68710578-68710600 CATTGTGTCAGGAGGAGAGAAGG - Intronic
1010790327 6:80056515-80056537 CACAGTGACTGGAGTATACTTGG + Intergenic
1010832420 6:80547140-80547162 CATTGTCACTGGAATGGAGGAGG - Intergenic
1011790669 6:90895076-90895098 CATTCAGAGTGGAGTAGATTGGG + Intergenic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1013113191 6:107080438-107080460 TATGGTGACTGGAGTAGGGTGGG - Intronic
1013176589 6:107683025-107683047 CATCTTGATGGGAGTAGAGTAGG - Intergenic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1014007870 6:116442202-116442224 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
1015609769 6:135004156-135004178 CATAGTGCCTGGTGTATAGTAGG - Intronic
1016259342 6:142148898-142148920 TATTGTGACTGGAGTGGATGGGG + Intronic
1016912659 6:149214570-149214592 CAGTGTGACTGGAGCACAGAGGG - Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018049949 6:160000327-160000349 CATGGTGACAGGAGAGGAGTGGG + Intronic
1020328901 7:6998491-6998513 CATAGTGGCTGAAATAGAGTAGG - Intergenic
1022671870 7:32463256-32463278 CATTGGGCCTGGAGGAGTGTAGG - Intergenic
1022888993 7:34676701-34676723 CACTGTGTCTGGCATAGAGTAGG + Intronic
1024823169 7:53358198-53358220 CATAGTGACTGGACCATAGTAGG - Intergenic
1026557273 7:71419534-71419556 CATTGTGACTTGAATAAGGTGGG + Intronic
1026954287 7:74367087-74367109 GATTAGGACTGGATTAGAGTGGG - Intronic
1027597756 7:80196862-80196884 AATTGTTACTATAGTAGAGTAGG + Intronic
1027669826 7:81082126-81082148 CATAGTGAGTAGAGTACAGTTGG - Intergenic
1028427504 7:90706763-90706785 CATTGTGACTGAACCATAGTTGG + Intronic
1029075926 7:97934106-97934128 CAGTCTGACTGGAGGAGAGTGGG + Intergenic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1030318501 7:108140691-108140713 CAATGTGGCTAGAGCAGAGTGGG + Intergenic
1031350798 7:120728459-120728481 CATTGTATCTGTAGTAGAGATGG + Intronic
1031696039 7:124855889-124855911 AATTGTGTCTGGATAAGAGTAGG + Intronic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1032927467 7:136623953-136623975 CATTTTTACTGGAGTACTGTTGG - Intergenic
1034842529 7:154412519-154412541 CATTGTGATTGCATTAGAGATGG - Intronic
1036306373 8:7605639-7605661 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036357219 8:8053624-8053646 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036367731 8:8135666-8135688 CATAGTGGCTGAAATAGAGTAGG + Intergenic
1036883150 8:12529995-12530017 CATAGTGGCTGAAATAGAGTAGG - Intergenic
1036901350 8:12671629-12671651 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1038690732 8:29760735-29760757 CTCTGTGACTGAAGTAAAGTAGG + Intergenic
1039765637 8:40625306-40625328 CATTATAACTGGAATAGAATTGG - Intronic
1040489512 8:47906590-47906612 CACTGTGTCTGGAGTGCAGTGGG - Intronic
1041239186 8:55834427-55834449 AATTGGGACTGGAGTAAATTGGG - Intergenic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042503095 8:69530932-69530954 CATTCTGTCTGGAGTACAGTAGG - Intronic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1045845033 8:106624324-106624346 TAATGAGACTGGAGTAGGGTAGG + Intronic
1046173573 8:110545643-110545665 CCATGTGACTGCAGTAGAGTTGG - Intergenic
1046346521 8:112935647-112935669 TATAATGACTGGATTAGAGTGGG + Intronic
1048293240 8:133196159-133196181 CACTGTGCCCAGAGTAGAGTGGG - Intronic
1050203425 9:3173432-3173454 CATTTGGCCTGTAGTAGAGTTGG - Intergenic
1050221637 9:3397603-3397625 CAAGGTGACAGGAGTAGACTTGG + Intronic
1051033114 9:12707545-12707567 AACTGTGGCTGGAGTAGAGTGGG + Intronic
1051362226 9:16291372-16291394 CATGGTGACTGTAGTACAGTGGG + Intergenic
1051463350 9:17348890-17348912 GATTATGGCTGGAGTAGGGTGGG + Intronic
1053276139 9:36784836-36784858 GATTGTGAATGGAGTTGAGGAGG + Intergenic
1055249585 9:74286988-74287010 CAATGTGGCTGGAGCAGGGTGGG - Intergenic
1055991740 9:82113669-82113691 CATGGTGATTGGCTTAGAGTAGG - Intergenic
1056245944 9:84695583-84695605 AATTGAGACTGGAGAAGATTTGG + Intronic
1056474556 9:86941314-86941336 CCTTGTGAGTGAAGTAAAGTTGG - Intergenic
1057786913 9:98094651-98094673 CAGTGTGACTGGAGAAGGGCAGG + Intronic
1057834788 9:98435650-98435672 CAGTGTGGCTGGAATAAAGTGGG - Intronic
1059093264 9:111384482-111384504 CATTGGGAATGGAGTGGAGCAGG - Intronic
1059422757 9:114202654-114202676 CTGTATGACTGGAATAGAGTGGG - Intronic
1060463666 9:123883000-123883022 CATTGTGGCTGGAGTTCAGTGGG - Intronic
1060535051 9:124379344-124379366 CATGGTGACTGGGGCATAGTAGG - Intronic
1061408061 9:130403497-130403519 CATGGTGACAGGAGAAGGGTTGG - Intronic
1062057034 9:134474126-134474148 CAGGGTGACTGCAGCAGAGTGGG + Intergenic
1062234069 9:135499849-135499871 CATTGTGCCTGGAGGAGAAGCGG + Exonic
1186895166 X:13998114-13998136 CATTCTGACTGGAGTGCAGTGGG + Intergenic
1188630327 X:32349542-32349564 GAATGTGACTGGAGAAGGGTAGG - Intronic
1188874529 X:35413802-35413824 CATTGTGAATGGAGCAGATTTGG - Intergenic
1189337309 X:40177670-40177692 CATTGTGGCTGGCATATAGTAGG + Intergenic
1190430214 X:50371622-50371644 CATGGTGACTGTAGTACAGGGGG - Intronic
1192226343 X:69230800-69230822 CAGTGTGAAGGCAGTAGAGTGGG - Intergenic
1194442233 X:93946780-93946802 CATTCTGACTGGAGTTGAGATGG - Intergenic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1196704992 X:118709825-118709847 CTGAGTGACTGGAGTGGAGTGGG - Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198637911 X:138720094-138720116 AATAGTGCCCGGAGTAGAGTTGG - Intronic
1200010841 X:153119660-153119682 CCTTCTGACTGGAGAAGAGGAGG + Intergenic
1200028759 X:153280262-153280284 CCTTCTGACTGGAGAAGAGGAGG - Intergenic
1200942462 Y:8799376-8799398 AAGTGTAACTGGAGTAGACTAGG + Intergenic
1200943954 Y:8813270-8813292 GATAGTGACTAGAATAGAGTTGG - Intergenic
1201695691 Y:16822794-16822816 CAATGTGACTTGAGGGGAGTAGG - Intergenic