ID: 1087666994

View in Genome Browser
Species Human (GRCh38)
Location 11:101061606-101061628
Sequence ATTTGTCTATAGCAGTATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087666994 Original CRISPR ATTTGTCTATAGCAGTATAA GGG Intronic
908988978 1:70061397-70061419 CTTTGTGTCAAGCAGTATAAAGG + Intronic
910187758 1:84562607-84562629 ATTTACCTTTAGCATTATAAAGG - Intronic
911701167 1:100953259-100953281 AGTTTTTTATAGCAGTATGAAGG + Intronic
915208781 1:154290807-154290829 TTCTGGCTATAGCAGTGTAAAGG + Intergenic
916238621 1:162615854-162615876 ATTTTTCTTTAGGAGTTTAATGG + Intergenic
916409935 1:164536907-164536929 ATATGTCTAGAGCATTCTAATGG + Intergenic
918698643 1:187579054-187579076 CTTTGTCGATAGCAGTTAAAGGG - Intergenic
920016951 1:202919577-202919599 AGATGTCAATAGCACTATAAAGG - Intronic
920901360 1:210113286-210113308 GTTTATCTAGAGCAGAATAATGG + Intronic
921541215 1:216418071-216418093 ATTTGTCTGTTGCATTAAAATGG - Intronic
1064697284 10:17980554-17980576 ATTTGTCCATCTCAGAATAAAGG - Intronic
1066170079 10:32832910-32832932 ATTTGACAATAGCAGCACAAAGG + Intronic
1066609560 10:37226794-37226816 ATTTTTCATTAGCAGTATGAGGG + Intronic
1068098165 10:52518303-52518325 TTATGTCTATACCAGTAAAAGGG - Intergenic
1068329939 10:55550036-55550058 ATTTGTACATAGCAATATAATGG - Intronic
1070023352 10:72608050-72608072 ATTTGATTAGAACAGTATAAAGG - Intronic
1070731718 10:78833244-78833266 CTTTGGCTCTCGCAGTATAAAGG - Intergenic
1071052215 10:81464658-81464680 ATTTTTGTATAGCTGTACAATGG - Intergenic
1074344319 10:112667537-112667559 AATTGCCTATAACAGTATAAGGG + Intronic
1078276102 11:9848725-9848747 ATTTGTGTATAGCAATATGAAGG + Intronic
1079919791 11:26418679-26418701 GTTTGTTTGTAGCAGTAAAATGG - Intronic
1079938241 11:26644054-26644076 ATTTTATTATAGCAGCATAAAGG + Intronic
1079995883 11:27294507-27294529 ATTCCTTTATAGCAGCATAAAGG + Intergenic
1081711334 11:45218172-45218194 CATTGTGTATAGCAGTACAAAGG - Intronic
1082677619 11:56127082-56127104 ATTTGTATTTATCAGAATAAAGG + Intergenic
1083568290 11:63739615-63739637 ATTTGTCCATAGCTTTAAAAAGG + Intronic
1084158573 11:67330834-67330856 ACTTGCCTATTGCAGTAAAAAGG + Intronic
1086188227 11:84045753-84045775 ATTTCTCTACAGCAAAATAAAGG + Intronic
1086719238 11:90099805-90099827 TTTTGTCTATTGCAGTATCTTGG - Intergenic
1087480143 11:98690132-98690154 ATTTGTCAGTAGGAGCATAAAGG - Intergenic
1087666994 11:101061606-101061628 ATTTGTCTATAGCAGTATAAGGG + Intronic
1093665033 12:21802375-21802397 ATTGTTCAATAGAAGTATAATGG + Intronic
1098194303 12:67983621-67983643 ATTCCTTTATAGCAGTACAAAGG + Intergenic
1098769205 12:74532050-74532072 ATTTGTATATATAAGCATAAAGG - Intergenic
1098895312 12:76053465-76053487 TGTTTTCTATAGCAGTATAAAGG + Intronic
1104305227 12:127604043-127604065 ATATGTCTATATCATTATACAGG + Intergenic
1106640030 13:31574340-31574362 ATTTGTCTATGTGAGTCTAAAGG - Intergenic
1108456401 13:50618986-50619008 ATGTGTGTATAACATTATAAAGG + Intronic
1109966869 13:69711631-69711653 ATTTGTTTATAACTGCATAACGG + Intronic
1110407964 13:75171607-75171629 AATTGTGTATAACATTATAATGG + Intergenic
1112136131 13:96579736-96579758 ATTTGTCTATGGCAGAGAAAGGG - Intronic
1113011439 13:105771992-105772014 AGTTGGCTATAGCAGGAAAATGG + Intergenic
1113156649 13:107330354-107330376 ATTTGTCAATATCACCATAACGG + Intronic
1114505543 14:23209519-23209541 ATTTGTTTATATCAGTATGGAGG - Intronic
1115042688 14:28950422-28950444 ATGTGTCAATAGTAGTTTAATGG + Intergenic
1119374189 14:74175754-74175776 ATTTTGGTATAGCTGTATAATGG - Intronic
1120060330 14:79975315-79975337 ATTTGTATAGGGTAGTATAATGG + Intergenic
1123897827 15:24846293-24846315 ATTTTTCATTATCAGTATAAAGG + Intronic
1126031234 15:44499910-44499932 GTTTTTCTGTAGAAGTATAATGG + Intronic
1126353102 15:47765588-47765610 ATTTGACTATAGAAATAAAAAGG - Intronic
1127695991 15:61448328-61448350 AATTTTCTAAAGCAGTAAAATGG - Intergenic
1131213969 15:90521596-90521618 ATTTTTCTATTTAAGTATAATGG + Intergenic
1138020685 16:53477735-53477757 ATTTGCCTACAACAGTACAAAGG - Intronic
1140626486 16:76800940-76800962 ATTTGTATGTAGCAGCAAAATGG + Intergenic
1143286793 17:5795981-5796003 ATGAGTCTGTAGCAGTGTAAAGG + Intronic
1144124129 17:12185003-12185025 ATTTGACAATAACAGTACAAAGG + Intergenic
1144124280 17:12187484-12187506 ATTTGACAATAGTAGTACAAAGG - Intergenic
1147655414 17:42087851-42087873 ATTTGGCTGTAACAGTATATTGG - Intergenic
1150978342 17:70113783-70113805 ATTCTTCTATAGCACTATCATGG + Intronic
1151502961 17:74503987-74504009 ATTTATCTAGAACAGAATAATGG - Intergenic
1152115413 17:78383682-78383704 GTTTGTTTATAGCAGTATAATGG + Intronic
1152991023 18:363589-363611 ATTTGGCTCTAACAGTAAAACGG + Intronic
1153181280 18:2437044-2437066 ATTTGAATATAGCAACATAATGG - Intergenic
1153188803 18:2515764-2515786 AGTTGTCTATAGGATTAAAATGG + Intergenic
1156831812 18:41500742-41500764 ATTTTTTTATAGCACAATAAAGG - Intergenic
1157660666 18:49439542-49439564 ATTTCTCTTTAGCAGTATGCTGG - Intronic
1163259978 19:16183177-16183199 ATTTATCTAGGGCAGTATTAGGG + Intergenic
1164180944 19:22818162-22818184 ATTGGTCCATAGCAGCATAAAGG + Intergenic
1164605141 19:29592611-29592633 ATTTGCCTTTAGCTGTAGAAGGG + Intergenic
1165359372 19:35326548-35326570 ATTTCGCTGGAGCAGTATAAAGG - Intronic
1166020683 19:40025706-40025728 ATTTGACAATAACAGCATAAAGG - Intergenic
1166024079 19:40063986-40064008 ATTTGACAATAGCAGCATAAAGG - Intergenic
1166744971 19:45137305-45137327 ATTACTCTTCAGCAGTATAAAGG + Intronic
925578271 2:5383178-5383200 AGTTGTGTAGAGCAGGATAAAGG + Intergenic
925645373 2:6030193-6030215 ATTCCTTTATAGCAGCATAAAGG + Intergenic
926740251 2:16104618-16104640 ATTTGCCAATAACTGTATAATGG - Intergenic
930285709 2:49424896-49424918 TTTTGCCTAAAGCAGAATAATGG - Intergenic
931156113 2:59632385-59632407 ATTTGTCTAAAGAAGTAAACAGG - Intergenic
936396741 2:112137498-112137520 ATTTTGCTATAGCAGTTTGAAGG + Intergenic
936584663 2:113745209-113745231 ATTTGTCTCTATCAGTACAGAGG - Intronic
937365688 2:121259394-121259416 ATATATCTATAGCTCTATAAAGG - Intronic
937623309 2:124015039-124015061 ATTTGTTTATAGCAGTAATGAGG - Intergenic
937780555 2:125831708-125831730 ATTTGTCAAGAGTAGTAGAAAGG - Intergenic
938396369 2:130951964-130951986 ATATGTCAATAACAGCATAAAGG - Intronic
938711890 2:133982127-133982149 ATTGGTCTATGGCAGGATATTGG + Intergenic
939242952 2:139585536-139585558 ATTTGTCTTTAGAAATCTAAAGG + Intergenic
940368385 2:152874373-152874395 ATTTTGTTATAGCAGTCTAAAGG - Intergenic
940820423 2:158348694-158348716 ATTTGTGGGTAGCAGTATAGAGG + Intronic
941276333 2:163495270-163495292 ATTTCTTCATAGCAGCATAATGG + Intergenic
941396264 2:164977562-164977584 ATTTGTCTTTTTAAGTATAAAGG + Intergenic
941513623 2:166444878-166444900 GTTTGTCCATAGGATTATAATGG - Exonic
944048963 2:195444920-195444942 ATTGGGCTCTAGCAGTAAAAGGG + Intergenic
944143868 2:196485343-196485365 ATTTTGTTATAGCAGTAAAACGG - Intronic
946653943 2:221924583-221924605 AATTGTCTATAGCTGTAGTAGGG - Intergenic
947417544 2:229913312-229913334 ATTTGTCTAAAACTGTATATAGG - Intronic
948812249 2:240486234-240486256 ATTTGGCAATAACAGTACAAAGG - Intronic
1170960955 20:21025566-21025588 AGTTGGCTTTAGCGGTATAATGG + Intergenic
1171500725 20:25591096-25591118 AATTTTCTACAGCAGTAAAATGG - Intergenic
1175299247 20:57931290-57931312 ATCTCTCTATAGCTATATAATGG + Intergenic
1178057668 21:28817703-28817725 ATTTGTCTATAAAAGTAGCAGGG + Intergenic
1182404393 22:30112485-30112507 ATCTGTGTAAAGCTGTATAAGGG - Exonic
1182890800 22:33817404-33817426 ATCTGTCTATGGCTGTAAAATGG - Intronic
950249191 3:11449881-11449903 AGTTGTCTATAAGAGTTTAAGGG + Intronic
951079118 3:18430359-18430381 ATTTGTATTTAGCAGTATACAGG - Intronic
953066569 3:39477910-39477932 ACTTTTCTATAGCTATATAATGG + Intronic
953073067 3:39542717-39542739 ATTTGTCTTTATGAGTACAATGG - Intergenic
954859851 3:53678507-53678529 ATTTATCTTTAGAAGTTTAAGGG + Intronic
955514497 3:59713409-59713431 ATTTGTCCACAGGTGTATAAAGG - Intergenic
956424789 3:69122772-69122794 ATTTGTGTATGGCAATATGATGG - Intronic
957986909 3:87583831-87583853 ATTCTTTTATAGCAGCATAAAGG - Intergenic
958601764 3:96303086-96303108 ATATTTCCATTGCAGTATAATGG - Intergenic
959212919 3:103411223-103411245 ATTTCTCTAAAGCAGTTAAAAGG + Intergenic
960372510 3:116858327-116858349 ATTTGTCTATAAGATTATACTGG - Intronic
963884822 3:150570200-150570222 ATTTGACTAGAGAAGAATAATGG + Intronic
966236781 3:177710133-177710155 ACATGTCTATAACAGTAAAAAGG - Intergenic
967047052 3:185747204-185747226 ATTTCTTCATAGCAGTAAAACGG - Intronic
967229723 3:187325977-187325999 ATTTGTCTTTAGTAATAAAAGGG + Intergenic
967592332 3:191293414-191293436 ATTGATCTATAGAAGTAAAAAGG - Intronic
970379493 4:15492758-15492780 ATTTGGCTATAGCAATAGAGTGG - Intronic
970832170 4:20353024-20353046 ATTTGAATGCAGCAGTATAACGG + Intronic
973701414 4:53540798-53540820 ATTTGTCTTTAGTAAAATAAGGG + Intronic
975026488 4:69555399-69555421 ATTTTTATATTTCAGTATAAAGG - Intergenic
975859401 4:78660178-78660200 ATGTGTGTATGGCATTATAAAGG - Intergenic
976636629 4:87292847-87292869 ATTTTTGTATAGCTGTACAACGG + Intergenic
976798966 4:88966452-88966474 ATTTGGCTATAGCAGGAAAAAGG - Intronic
976843924 4:89464914-89464936 ATTTTGCTACAGCAGCATAAAGG + Intergenic
977013797 4:91666902-91666924 ATTTGGCTATATCAATATACAGG + Intergenic
977465034 4:97373225-97373247 ACTTTTCTATAGCTTTATAAAGG - Intronic
978987584 4:115033045-115033067 ATTTATCTATAGAACTCTAAAGG + Intronic
979938529 4:126728588-126728610 ATTTATTTATAAAAGTATAAAGG + Intergenic
984041251 4:174736651-174736673 ATTTGTTTATAGAAGTGTGAAGG + Intronic
985261745 4:188120739-188120761 AGTTGTCTATTGCATTGTAACGG - Intergenic
986323806 5:6656469-6656491 TTTTGTTTCTAGCAGTATAATGG + Intronic
986850417 5:11805671-11805693 ATGTGTCTATACTAATATAAAGG + Intronic
986867304 5:12005086-12005108 ATTTGTGTAAATCTGTATAATGG - Intergenic
987287594 5:16473402-16473424 ATTAGTCTTTAGAAATATAAGGG + Exonic
987992065 5:25225760-25225782 ATCTGCTTATACCAGTATAATGG - Intergenic
988226359 5:28416934-28416956 GTTTGTTTATACCAGTATTATGG + Intergenic
988656419 5:33216805-33216827 ATTTTGTTATAGCAGTAAAAAGG + Intergenic
988901168 5:35734086-35734108 TCTTGTCTAGAGCAGTATAGGGG - Intronic
989140402 5:38195963-38195985 ACTTGTCAATCCCAGTATAATGG + Intergenic
991309588 5:65222126-65222148 ATATGTATATAGAAATATAAAGG + Intronic
992019615 5:72609089-72609111 GTTTGTCTATGGCAGGATAAGGG + Intergenic
992137367 5:73760935-73760957 AATTCTCTATTCCAGTATAAGGG - Intronic
993946763 5:94124404-94124426 ATTTGTCAATTACAGTTTAAAGG - Intergenic
994997373 5:107080966-107080988 ATTTTTGTATAGCTGTACAATGG - Intergenic
995733962 5:115277720-115277742 AATTGTCTTTATCAGCATAAAGG + Intronic
1003383045 6:5642262-5642284 ATTTCTCTAGGGCACTATAAAGG + Intronic
1009286447 6:61824536-61824558 AGTTCTTTATAGCAGTGTAATGG + Intronic
1009714231 6:67367574-67367596 ATCTGTCTATAGAACTATACTGG + Intergenic
1009746485 6:67822956-67822978 CTTTGTCTCTGGCAGTAGAAGGG - Intergenic
1011231232 6:85164556-85164578 AATTATCTATAGCAGAATGAAGG - Intergenic
1012756868 6:103242554-103242576 ATATGTTTATAGCATTCTAAAGG - Intergenic
1013330712 6:109097155-109097177 ATTTGGCCATAGAAGTATGAAGG - Intronic
1014735625 6:125092978-125093000 ATTTGGCTTTAGCAGTTTAGTGG - Intergenic
1015057046 6:128916155-128916177 AATTTTCAATAGCAGTTTAATGG + Intronic
1015706518 6:136093964-136093986 ATTTGGCTATAGCAGTCTGAAGG - Intronic
1018242229 6:161788884-161788906 ATTTATCTATATCTGTATATAGG - Intronic
1018320728 6:162605658-162605680 ATATGTCTATATAAGTATACAGG - Intronic
1018483915 6:164220334-164220356 ATTTGTCTTTAACTGTAGAAAGG + Intergenic
1020398277 7:7743380-7743402 ATTTGTCAAAAACAGTATTAAGG + Intronic
1020642530 7:10773936-10773958 ATTTGTATTTCTCAGTATAATGG - Intergenic
1021022451 7:15620241-15620263 ATTTCTTTACAGCAGTATATAGG - Intronic
1021260822 7:18454830-18454852 ATTTTTCTATAGCTTTGTAAAGG + Intronic
1021643627 7:22765566-22765588 ATTAGACAATACCAGTATAATGG + Intergenic
1025271139 7:57518204-57518226 AGTTGTATATAGCAGCATAATGG + Intergenic
1025781465 7:64605401-64605423 ATTTGTCTATATCATCACAAAGG + Intergenic
1027721082 7:81742343-81742365 ATTTCACTATAGCAGAATGATGG - Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1027914724 7:84301734-84301756 ATTTGTGAATAGAAGTATATGGG - Intronic
1028038974 7:86022927-86022949 ATTTGTCTCTAGAGGTATTAAGG + Intergenic
1028930995 7:96412850-96412872 ATTGATGTATAGCAGTAAAATGG + Intergenic
1031834819 7:126669636-126669658 GTTTGACTATAGCATAATAAGGG - Intronic
1031903365 7:127434432-127434454 ATTTCTTTATAGCAGTGTGATGG - Intergenic
1033410350 7:141111984-141112006 ATTTGTCTCTAGAAGTATTAAGG + Intronic
1033484959 7:141779672-141779694 CATTGTCTATTGAAGTATAATGG + Exonic
1033493490 7:141869149-141869171 ATTTGACTAGAGAAGTATAGAGG + Intergenic
1034211592 7:149368129-149368151 ATTTATCTATTCCACTATAAAGG + Intergenic
1038854002 8:31311228-31311250 CTTTGTATATGGCAGTATATAGG - Intergenic
1040453931 8:47576743-47576765 ATTTTTATAAAGCAGTCTAATGG + Intronic
1040546200 8:48399842-48399864 ATTAGTCTCTAGCTGTATCATGG - Intergenic
1040868301 8:52072825-52072847 ATTTGCCAATAGCATTACAAAGG - Intergenic
1041449013 8:57987524-57987546 AGTTGTCTGTATCAGTCTAATGG - Intergenic
1042013185 8:64273767-64273789 ATTTGTCAAGAGCACTACAAAGG + Intergenic
1044181492 8:89201280-89201302 ATTTGTCTGTAGCTGTGCAATGG - Intergenic
1045453660 8:102354269-102354291 TTTTGTCTATAGGAGAATACAGG - Intronic
1051049512 9:12914527-12914549 ATGTGTCCATAGCAGGAAAAGGG + Intergenic
1051757079 9:20413472-20413494 ATATTTCCATAGCATTATAATGG - Intronic
1053077570 9:35146756-35146778 ATTTGTATATAGCTTTAAAAGGG - Intergenic
1053612335 9:39727865-39727887 AGCTGTCTAAAGCAGTAGAAAGG + Intergenic
1053870370 9:42485864-42485886 AGCTGTCTAAAGCAGTAGAAAGG + Intergenic
1054085916 9:60743284-60743306 AGCTGTCTAAAGCAGTAGAAAGG - Intergenic
1054241182 9:62614527-62614549 AGCTGTCTAAAGCAGTAGAAAGG - Intergenic
1054555311 9:66649051-66649073 AGCTGTCTAAAGCAGTAGAAAGG - Intergenic
1054709684 9:68498817-68498839 ATTTGTCTATTACAGTAAGACGG - Intronic
1055234309 9:74101650-74101672 TTTTCTCTATAGCATTCTAAGGG - Intergenic
1055399370 9:75906752-75906774 ATTTGCCTATTGCATTACAATGG + Intronic
1058566057 9:106286691-106286713 ATTTGTCTATCTATGTATAAAGG + Intergenic
1059610309 9:115885096-115885118 ATTTTTCTAAAACAGTATGATGG - Intergenic
1187922358 X:24217466-24217488 ATGTGTCTACACCAGTATATGGG + Intergenic
1187939307 X:24365731-24365753 ATTTCTCTAAAGCCGTAAAATGG + Intergenic
1193493679 X:82183843-82183865 ATGTGTGTATAGCAGGAAAAGGG + Intergenic
1194843024 X:98768367-98768389 ATTTGTATATACCCATATAATGG + Intergenic
1196925315 X:120628546-120628568 ATTTCTCAATATCAGTTTAATGG + Intronic
1196962930 X:121023780-121023802 ACTTGTCTTTGCCAGTATAAGGG - Intergenic
1197277784 X:124499950-124499972 ATTTTTTTATATCAATATAATGG + Intronic
1202073889 Y:21019127-21019149 ATGTGTCCATACCAGTAAAAAGG - Intergenic
1202078589 Y:21060981-21061003 ATGTGTCCATACCAGTAAAAAGG - Intergenic