ID: 1087670128

View in Genome Browser
Species Human (GRCh38)
Location 11:101096587-101096609
Sequence CTGTATATGCAGGTGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087670124_1087670128 1 Left 1087670124 11:101096563-101096585 CCACTCGCTACTTCAGGTACCTG 0: 1
1: 0
2: 0
3: 4
4: 98
Right 1087670128 11:101096587-101096609 CTGTATATGCAGGTGAAGAAAGG 0: 1
1: 0
2: 2
3: 11
4: 216
1087670120_1087670128 28 Left 1087670120 11:101096536-101096558 CCAAGAATGCAATGAATGCAGTG 0: 1
1: 0
2: 6
3: 32
4: 591
Right 1087670128 11:101096587-101096609 CTGTATATGCAGGTGAAGAAAGG 0: 1
1: 0
2: 2
3: 11
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087670128 Original CRISPR CTGTATATGCAGGTGAAGAA AGG Intronic
900692155 1:3987381-3987403 CTGTACATGGAGGTGAGGGAAGG + Intergenic
902560525 1:17274509-17274531 CTGTATTTCCACCTGAAGAATGG + Intronic
904806246 1:33134440-33134462 CTGTTTATTTAGTTGAAGAATGG + Intergenic
906423673 1:45691201-45691223 TTGTATATTCAGGTGATGGAGGG + Intronic
911144309 1:94538056-94538078 CTGTATAAACAGGTAATGAAGGG + Intronic
911499741 1:98670418-98670440 CTGGAAATGCAGCTGCAGAAAGG + Intronic
912668613 1:111605610-111605632 CTGTCTTGGTAGGTGAAGAAAGG + Intronic
913564111 1:120054224-120054246 CTGAGCATGCAGGTGAAGGACGG + Intronic
915016908 1:152742872-152742894 ATGTACAAGCAGGTCAAGAAAGG - Intronic
915329092 1:155098433-155098455 CAGTATATGCATATGAGGAAAGG - Intergenic
916053477 1:161051931-161051953 CTGTATCTGCAGGGAAGGAAGGG - Intronic
917488862 1:175480155-175480177 CTGACTATGCAGCTGGAGAATGG - Intronic
918048643 1:180955981-180956003 CTGTTCATGCAGGTGCAGCAGGG - Intergenic
919456578 1:197827608-197827630 CTGTATATCTAGGAGTAGAATGG - Intergenic
920252211 1:204629232-204629254 CCAGATATGCAGGTGAGGAAGGG - Intronic
923011368 1:230090514-230090536 GTGTGTGTGGAGGTGAAGAATGG + Intronic
923522712 1:234748278-234748300 CTGGAAATGCAGGGAAAGAAAGG - Intergenic
923732283 1:236563812-236563834 CACTATATCCAGGTAAAGAAAGG + Intronic
924321722 1:242857574-242857596 GTGTATATGTAGGTGTGGAATGG - Intergenic
1063301680 10:4854706-4854728 GTGTATACCCAGGTAAAGAATGG + Intergenic
1063610090 10:7554403-7554425 CTGCTTCTGGAGGTGAAGAAAGG + Intergenic
1066676348 10:37891504-37891526 CTGTATCTGCAGGTGTGGCAGGG + Intergenic
1067982837 10:51106588-51106610 CTGTCTCTGCTGCTGAAGAAAGG - Intronic
1069372994 10:67766808-67766830 CTGTATATGCATATTAAAAATGG - Intergenic
1073901179 10:108222785-108222807 CTGTATATTTATGTAAAGAAAGG - Intergenic
1074789775 10:116875260-116875282 CTGTGTATGCTGGTGTAGAATGG - Intronic
1074849397 10:117427048-117427070 CTGTATGTCCAGGTGAAGGCTGG + Intergenic
1077482788 11:2824359-2824381 CTGGATATGGTGGTGAAGGAGGG + Intronic
1079523375 11:21355451-21355473 CTGTATAATCAGGTCAATAAGGG - Intronic
1079936064 11:26617881-26617903 CTGTATATTCAGGTGATCAGAGG - Intronic
1080285513 11:30606747-30606769 CTGTCTAGGCTGGTGAGGAAAGG - Intergenic
1086344704 11:85884198-85884220 CTGGACATGCATGGGAAGAAAGG + Intronic
1087670128 11:101096587-101096609 CTGTATATGCAGGTGAAGAAAGG + Intronic
1088419362 11:109625533-109625555 TTGTGCATGCATGTGAAGAACGG + Intergenic
1088792870 11:113241651-113241673 CTGAATGTGCAGGAGTAGAAGGG + Intronic
1088809545 11:113381941-113381963 CTGGCTCTGCAGGTAAAGAAAGG - Intronic
1090261780 11:125326457-125326479 CTGATTATGAAGGGGAAGAATGG + Intronic
1091132159 11:133155566-133155588 CTGGGTATGCGGGTGAAGTAAGG - Intronic
1091190705 11:133693318-133693340 CTGTGTCTGCTTGTGAAGAAAGG + Intergenic
1092611350 12:10176477-10176499 CTGTTTAGGCAGGTGAAGGCTGG + Intronic
1092650762 12:10632261-10632283 TTATATATGAAGGTCAAGAAAGG + Intronic
1092871140 12:12806951-12806973 ATGTATGTTCAGATGAAGAAAGG - Intronic
1093896672 12:24582605-24582627 CAGTAAATGCAGGAAAAGAAGGG + Intergenic
1096895971 12:54820907-54820929 CTGCATATGGAGGTCAAGAGGGG - Intergenic
1097433201 12:59532000-59532022 CTTTATATCCAGGGGAAGAGAGG + Intergenic
1098013885 12:66083721-66083743 CTGTATATCCATGTGAAGGCTGG - Intergenic
1098245203 12:68509922-68509944 CTGCAGGTGCAGGAGAAGAAGGG + Intergenic
1100543600 12:95580642-95580664 ATGTATATGTAGGTGGGGAAAGG + Intergenic
1102563742 12:113780982-113781004 GTGCATATGCAGGGGAAGGAAGG - Intergenic
1104370262 12:128218084-128218106 CTGAATATGCAGGACATGAAGGG + Intergenic
1105257287 13:18752416-18752438 ATGTAGATGCAGGTTCAGAAGGG - Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107069883 13:36257875-36257897 CTGAATATGGAGGTCAAGAGGGG - Intronic
1108596134 13:51951242-51951264 CTGAATATGAGGGTAAAGAAAGG + Intronic
1111574728 13:90137683-90137705 CTGTCTTTGAAGATGAAGAAAGG + Intergenic
1112558336 13:100489789-100489811 TTATAAATGCAGGTGAACAAGGG + Intronic
1113909457 13:113835231-113835253 CCGTCTATGCAGGTGGAGAAGGG + Intronic
1114189254 14:20428617-20428639 CTGAATACCCAGGTGAGGAAAGG - Intergenic
1114684264 14:24513287-24513309 ATGGAAATGCAGGTCAAGAATGG + Intergenic
1116067493 14:40002599-40002621 ATGTATTGTCAGGTGAAGAATGG + Intergenic
1117340935 14:54790487-54790509 CTGTTTATGAAGGGCAAGAAAGG + Exonic
1118588773 14:67383951-67383973 CTGTAGGAGCAGGTGAATAAAGG + Exonic
1118690376 14:68333089-68333111 CAGTATATGCAGAGGCAGAAAGG - Intronic
1119310986 14:73646157-73646179 GTTTATATTCAGGTGAAGAAAGG + Intronic
1120303198 14:82734426-82734448 CTGTCTGTGGAGGTGAAAAAAGG - Intergenic
1121975255 14:98397497-98397519 CTGTAAATGTAGGTGATGCATGG - Intergenic
1122198110 14:100104946-100104968 CTGTAGCTGAAGGAGAAGAAGGG + Intronic
1122673926 14:103394366-103394388 CTGTACAAGCAGGTGCAGACGGG - Intronic
1125967690 15:43887465-43887487 GAGTATATTCAGGAGAAGAAAGG + Intronic
1126773775 15:52082377-52082399 CTGGATATGCAGCGGCAGAAAGG - Intergenic
1126800505 15:52293482-52293504 CTGTATTTGCAGGGGTTGAAGGG - Intronic
1127907467 15:63386733-63386755 CTTTATATGGAGCTAAAGAAAGG + Intergenic
1129026793 15:72583697-72583719 CTGTATGTGTAGGGGAGGAAGGG - Exonic
1131355451 15:91742038-91742060 GTGGAGATGCAGGTGGAGAATGG + Intergenic
1131809220 15:96154993-96155015 GTGTATATGCAGGAGGGGAAGGG + Intergenic
1134035696 16:11029321-11029343 CTGTGCATGCACATGAAGAAAGG - Intronic
1134414003 16:14028364-14028386 CTGGATGGGCAGGTGCAGAAAGG + Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1140264349 16:73407671-73407693 CTCTATATGCAGGAGAGGAAGGG - Intergenic
1142150609 16:88511006-88511028 TTGTCTCTGCAGCTGAAGAATGG - Intronic
1144016378 17:11200294-11200316 CAGTTTATGCAGGTGTAAAAGGG + Intergenic
1145072120 17:19819600-19819622 TTGTATAGGCAAGTGAACAAAGG - Intronic
1147878492 17:43638672-43638694 ATGTAAATGCAGGTGAATGAAGG + Intergenic
1151246133 17:72796380-72796402 CTCTATATGCATGAGAAGGAGGG + Intronic
1152003052 17:77658926-77658948 CGGTAAAGGAAGGTGAAGAAAGG + Intergenic
1156783314 18:40878619-40878641 CTGCATAAACAGGTGAAGACAGG + Intergenic
1156832960 18:41516872-41516894 CTGTATAAGCAGGAGAAGAATGG - Intergenic
1156842686 18:41628058-41628080 CTGAGTATCCAGTTGAAGAAGGG - Intergenic
1156916364 18:42467637-42467659 CTGTATAGGCACAGGAAGAAAGG - Intergenic
1158077363 18:53546150-53546172 CTGAAGATGCAGTTGAAGACAGG + Intergenic
1159278705 18:66255239-66255261 CCTTAGATGCAGGTGCAGAAAGG + Intergenic
1159495933 18:69204777-69204799 TTGGATATGCAAGTGAAAAATGG - Intergenic
1162760346 19:12885250-12885272 CTGTAGTTACAGGGGAAGAAGGG - Intronic
925696207 2:6582406-6582428 CTGAATATGAAAGTGAGGAAAGG - Intergenic
926066560 2:9844557-9844579 CTGTATATACAGGAGCAGTACGG + Intronic
928587886 2:32780224-32780246 TTGAATCTGCAGGTGAATAAGGG + Intronic
929312850 2:40445698-40445720 CTGCATGTCCAGGGGAAGAAAGG + Intronic
930037678 2:47097593-47097615 CTGTATCTGCACGTGGCGAAGGG - Intronic
930368001 2:50466844-50466866 CTGTATCTGCACATGATGAATGG - Intronic
933340101 2:81013556-81013578 ATGTATATGAAGGTTAAAAATGG - Intergenic
937044790 2:118845487-118845509 CTGGATGTGCGGGTGAAAAAAGG + Intronic
939026577 2:137020835-137020857 CTTTATGTCCAGGTGAAAAATGG - Intronic
939613975 2:144341904-144341926 CTACATATGCATGTAAAGAAAGG + Intergenic
939916176 2:148046579-148046601 CTGACTATGGAGGTAAAGAAGGG - Intronic
940023136 2:149177239-149177261 CTGGAAATGCATTTGAAGAATGG - Intronic
940106664 2:150108849-150108871 CTGTATCTTCAGTTGAAGGATGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941506118 2:166347792-166347814 CTTTAAATGCCTGTGAAGAATGG - Intronic
942998906 2:182299552-182299574 CTGTTTTTGCAGGTCCAGAATGG - Intronic
944366774 2:198930148-198930170 CTTAGTATGCAGGAGAAGAAGGG - Intergenic
1170867525 20:20172694-20172716 CTGTGTATGGTGGTGGAGAAGGG - Intronic
1171052520 20:21873292-21873314 GTGGATATTCAGGTGAAGATTGG + Intergenic
1172601390 20:36186011-36186033 GTGCATATACAGGTGAAAAATGG - Intronic
1174184307 20:48694866-48694888 CTGTGTCTGCCGGTGGAGAAGGG + Intronic
1175242370 20:57559156-57559178 CTGTAAATGCAGGTAATGAAAGG + Intergenic
1177227052 21:18271083-18271105 CTGTGTATGGAGGGGAAAAAAGG - Intronic
1178289083 21:31351194-31351216 CTCTATATGTAAGAGAAGAAAGG + Intronic
1178330151 21:31682888-31682910 ATGTGTATGCAAGTTAAGAAGGG - Intronic
1179772289 21:43631271-43631293 CTGGAAATGAAGGTGAAGAGGGG - Intronic
1184249409 22:43251593-43251615 CTGGCTCTGCAGGTGGAGAAGGG + Intronic
1184826666 22:46957183-46957205 CTGTATGCCCAGGTGAAGAGGGG - Intronic
1185420871 22:50733687-50733709 CTGTAAATGCAGCTGATGGATGG + Intergenic
950155983 3:10722053-10722075 ATGTTTATGCAGGTGAAGCTAGG + Intergenic
951371372 3:21853867-21853889 ATGTATATGAAGTTCAAGAAAGG + Intronic
952596398 3:35023748-35023770 CTGTATCTGCAGGGCAAGATAGG + Intergenic
953576672 3:44118201-44118223 ATGTGTATGCAGGTGAAAATGGG - Intergenic
954219434 3:49144012-49144034 CTGGCTATGCAGGTGAGGCATGG - Intergenic
954749312 3:52804709-52804731 CTGCATCTGCAGGTGCAGCAAGG - Exonic
955119472 3:56042130-56042152 CTATATGTGCAGGTGCAGGAAGG - Intronic
956170365 3:66428962-66428984 CTGTTTATTCAGGTGGAGACTGG + Intronic
957682189 3:83451275-83451297 CTGTATATGCAAATAAACAATGG + Intergenic
959281891 3:104352946-104352968 CTGTATATGCAGGCATGGAAAGG - Intergenic
959883799 3:111475803-111475825 CTGTATATGTAGAGGAAGAAAGG + Intronic
962146912 3:132849218-132849240 CCCTATATGCAGGACAAGAATGG - Intergenic
962852573 3:139318975-139318997 CTGGATATGCAGCTGCTGAACGG - Intronic
963081136 3:141394637-141394659 CTGGATAGGCTGGTGAAGGAAGG - Intronic
963492032 3:146014238-146014260 ATTTATATGCAGGTTTAGAATGG + Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
963618669 3:147576341-147576363 CTGCATCTGCAGGGGTAGAAGGG + Intergenic
964144190 3:153439070-153439092 CTGTAAGTGCATGTGAAGAGAGG - Intergenic
965493134 3:169364690-169364712 CTGGAAAGGCAGGTGATGAATGG - Intronic
969598909 4:8164177-8164199 CTGTATTTAGAGATGAAGAAAGG - Intergenic
970863162 4:20727326-20727348 CTCCATATGCTGTTGAAGAAGGG + Exonic
972155459 4:36155592-36155614 CAGTAGATGCAGGAGATGAAGGG + Intronic
973662001 4:53117614-53117636 CTTTATCTGGAGGTGTAGAAGGG + Intronic
974688079 4:65257595-65257617 CTGCATAAACAGGGGAAGAAGGG + Intergenic
975181526 4:71351261-71351283 CTTTAGCTGCATGTGAAGAAAGG - Intronic
976573604 4:86641667-86641689 ATGTAGATGAAGGTGATGAAAGG + Intronic
977682238 4:99809484-99809506 CTGTTTGTGCTGGTGAAGCAAGG - Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
984075366 4:175170945-175170967 CTGTATCTGCAGTGGAAGGAAGG - Intergenic
984891473 4:184498020-184498042 CTGAATATGGAGGTCAAGAGGGG - Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
987497563 5:18667851-18667873 TTGAATATCCAAGTGAAGAAAGG + Intergenic
987555649 5:19444244-19444266 CTGTATATAAAGGGAAAGAAGGG - Intergenic
988087925 5:26495749-26495771 CAGGATATGCAGGTCAAGATGGG - Intergenic
988136476 5:27177776-27177798 CAGTATATGCATGTTAAGTAAGG + Intergenic
992066798 5:73116937-73116959 TTGTGTATGAAGGTGATGAAAGG - Intergenic
993085520 5:83359002-83359024 CTGTATATGCAGGGGTGAAAAGG + Intergenic
994780866 5:104088417-104088439 TTGAATCTGCAGATGAAGAATGG - Intergenic
998711437 5:144829843-144829865 TTTTAGATGTAGGTGAAGAAAGG - Intergenic
998891980 5:146756038-146756060 TTGGAAATGCAGGAGAAGAATGG + Intronic
1000550888 5:162662757-162662779 CTGTTTTAGCAGGTGTAGAATGG + Intergenic
1002658798 5:180775840-180775862 CTCCATATGCAGGTGCAGCAGGG + Intergenic
1004891072 6:20101277-20101299 CTGTACATGGAGCTGAAGAGGGG - Intergenic
1005160741 6:22859753-22859775 ATGTATATGCATGGGAACAATGG - Intergenic
1005522273 6:26611804-26611826 CTGTATATGTAGGAGAATTAAGG + Intergenic
1005808583 6:29498763-29498785 CTGTGTATGCTTGAGAAGAATGG + Intergenic
1006824401 6:36923764-36923786 CTGGCCATGCAGGTGAAGAAAGG - Intronic
1007724962 6:43910091-43910113 CTGGACTTGCAGGTGAAGGAGGG - Intergenic
1007749756 6:44064655-44064677 CTGCACAGGCAGGGGAAGAAAGG + Intergenic
1008900580 6:56610700-56610722 CTGTATATGAAAATTAAGAATGG + Intronic
1009321622 6:62297709-62297731 CTGGCTTTGAAGGTGAAGAAAGG - Intergenic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009855564 6:69258422-69258444 ATGTATATAGAAGTGAAGAACGG + Intronic
1010292556 6:74154993-74155015 CTGTTTCTTCAGGTGAAGAATGG + Intergenic
1010865581 6:80973424-80973446 CTGTCTATGAAGATGAAGGAAGG - Intergenic
1012981942 6:105840432-105840454 CTGTATTTGCAGCTCAAGAGAGG + Intergenic
1013755313 6:113454855-113454877 CTATGTAGGCAGGTGAAGACTGG + Intergenic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015793823 6:136990350-136990372 CTCTATTTTCAGGGGAAGAATGG - Intergenic
1016250907 6:142041183-142041205 CTGTGTATGCAGTGGAAGAGTGG - Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1017696314 6:157019915-157019937 CTGCATATGAAGGGGAAGACAGG - Intronic
1019153840 6:170025942-170025964 CTGCATATGCAGGTTCAAAAGGG - Intergenic
1020801530 7:12738621-12738643 CTGTATACTGAAGTGAAGAAGGG - Intergenic
1023420806 7:39977669-39977691 CTTTATATGCAAGTCAAGCAGGG + Intronic
1023488844 7:40715634-40715656 TTGAATATGCAGGTAAAGACAGG - Intronic
1027361896 7:77417394-77417416 CTGTATATGGTGGTGAGTAATGG - Intergenic
1028867124 7:95726275-95726297 CTGTACATCCAGGGAAAGAAAGG - Intergenic
1030803855 7:113889053-113889075 CTGTATATGGAGGTGAAGATGGG + Intronic
1032936842 7:136742548-136742570 CTCTATTTGAAGGAGAAGAAAGG - Intergenic
1037566753 8:20124539-20124561 CTGACTTTGAAGGTGAAGAAAGG - Intergenic
1037571095 8:20158393-20158415 CTGTATGTTCAGGTGTATAATGG - Intronic
1039997328 8:42545078-42545100 CTCTATATACAGGAGAAAAATGG - Intronic
1040764818 8:50894882-50894904 CAGTATATGCCGATGATGAATGG - Intergenic
1040937468 8:52796257-52796279 CTGGAAAGCCAGGTGAAGAAAGG - Intergenic
1041021650 8:53644085-53644107 CTGTCTCAGCAGGTGAAGGAAGG - Intergenic
1044542403 8:93422490-93422512 CTGTTTATGTTGGGGAAGAATGG + Intergenic
1045331394 8:101158643-101158665 CTGTGTATGCAGATGATGGATGG + Intergenic
1046360007 8:113139390-113139412 CTGTAAATGCAGGGGTATAAAGG + Intronic
1046380127 8:113438831-113438853 CTGCATATGCAGGTTTCGAAGGG + Intergenic
1047011334 8:120675666-120675688 CTGGAAATGCAGGGGAACAAAGG + Intronic
1047632273 8:126721446-126721468 CTGTTTACCCAGGGGAAGAAAGG + Intergenic
1047919741 8:129622484-129622506 CCATAGAAGCAGGTGAAGAAAGG - Intergenic
1048173715 8:132132642-132132664 GTGTGTGTGCAGGTGGAGAAGGG + Intronic
1048499627 8:134963890-134963912 CTGCAGATGCAGGAGAAAAAGGG - Intergenic
1049582491 8:143418952-143418974 CTGCATTTGAAGATGAAGAAAGG - Intergenic
1050532344 9:6601416-6601438 CTGTATATAAAAGTGAAGACTGG + Intronic
1050778678 9:9302400-9302422 TTGCATATGCAGCTGGAGAAGGG - Intronic
1051154765 9:14129220-14129242 CTTTAGAGACAGGTGAAGAACGG + Intronic
1051433750 9:17007857-17007879 CTGTATAACCAGCTGAAGGAGGG + Intergenic
1056308942 9:85320661-85320683 CTGAATATGGAGGTCAAGAGGGG + Intergenic
1056566337 9:87776019-87776041 GAGAATATGCAGGAGAAGAAGGG - Intergenic
1056899271 9:90583364-90583386 CTGAATATGGAGGTCAAGAGGGG + Intergenic
1057538661 9:95943473-95943495 CTGTTTATGTAGATGTAGAATGG + Intronic
1058500789 9:105613603-105613625 CTGTATCTACAGGTTTAGAATGG - Intronic
1058595953 9:106615836-106615858 CTGCATAAGCAGATGAAAAAAGG + Intergenic
1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG + Intergenic
1185776756 X:2809342-2809364 GTTGATATGTAGGTGAAGAATGG + Intronic
1185933727 X:4232239-4232261 CTGTACATAAAGATGAAGAATGG - Intergenic
1186655075 X:11603506-11603528 GTGTATATGCATGTGTAGAGGGG + Intronic
1188746429 X:33850445-33850467 CTGTCTTTGAAGATGAAGAAAGG + Intergenic
1190500115 X:51067214-51067236 ATGTATATGCATGGGAAAAAAGG + Intergenic
1195849628 X:109269175-109269197 CTGTATTTGTAGGAGAAGAATGG + Intergenic
1196089823 X:111727721-111727743 CTTTTTATGAAGTTGAAGAAGGG + Exonic
1196578104 X:117345031-117345053 CTGTTTATGCAGATCAACAATGG + Intergenic
1199995284 X:153020805-153020827 GTGGATATCCAGGTGAAGACAGG - Intergenic
1200880148 Y:8204036-8204058 CTGAAAAAGAAGGTGAAGAAAGG - Intergenic
1201293240 Y:12442126-12442148 TTGGATGTGTAGGTGAAGAATGG - Intergenic