ID: 1087670336

View in Genome Browser
Species Human (GRCh38)
Location 11:101098973-101098995
Sequence TATCACATGGTATAGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087670333_1087670336 2 Left 1087670333 11:101098948-101098970 CCTTTAATGGGAGGTGAATTTTC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1087670336 11:101098973-101098995 TATCACATGGTATAGGAACCTGG 0: 1
1: 0
2: 0
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087670336 Original CRISPR TATCACATGGTATAGGAACC TGG Intronic
900780241 1:4613298-4613320 AAACACATGGTATATGAACAAGG - Intergenic
910202137 1:84710553-84710575 CCTAACATGGAATAGGAACCTGG + Intergenic
912787387 1:112618147-112618169 AATCACATGGTAAGGGGACCTGG + Intronic
913519251 1:119630457-119630479 TATCACAAGTTCTAGAAACCAGG - Intronic
920874220 1:209819174-209819196 TATCACAAGTTACAGGGACCCGG + Intergenic
923150549 1:231229414-231229436 TACCACATGGTATAGGCATTGGG + Intronic
923718048 1:236443076-236443098 TATCTCATGGCAAAGGAACTGGG - Intronic
924593298 1:245423425-245423447 TAGCACAGAGAATAGGAACCTGG - Intronic
1063912750 10:10848922-10848944 TCTCACATGGTCCAGGTACCTGG + Intergenic
1065092375 10:22247721-22247743 AATCACTTGGTATACAAACCTGG + Intergenic
1071855725 10:89622457-89622479 TATCAAAGGGTATAGGAATCTGG - Intronic
1076896232 10:133313675-133313697 TATCACATGCTGTGGGAACAGGG - Intronic
1079551175 11:21699886-21699908 TATTGCATGGTATAGATACCAGG - Intergenic
1081751455 11:45514058-45514080 CATCACATGGTTTAGGAAAGAGG + Intergenic
1086179186 11:83930065-83930087 TATTAAAATGTATAGGAACCAGG + Intronic
1087611367 11:100437899-100437921 CATCTCATGGTATAAGAACAAGG + Intergenic
1087670336 11:101098973-101098995 TATCACATGGTATAGGAACCTGG + Intronic
1095135651 12:38599221-38599243 TAACAGATGGTATAGAAAACTGG + Intergenic
1095628541 12:44346590-44346612 GATCCCATGGTATAGGCAGCAGG + Intronic
1095844116 12:46727830-46727852 TGTCACATGATAAAGGAAACAGG + Intergenic
1098999690 12:77164896-77164918 GATCACATGGTGTTAGAACCAGG + Intergenic
1099975767 12:89544174-89544196 TAACACATGGTTCAGGAAGCTGG - Intergenic
1101532153 12:105583153-105583175 TATCAAATGATATAGAAACACGG + Intergenic
1112282044 13:98071524-98071546 TATCTCATGAAATAGGAGCCAGG + Intergenic
1115766036 14:36624738-36624760 GATCCCATGGTATGGGACCCAGG + Intergenic
1125376102 15:39031302-39031324 GAGCACATGGTATAGTCACCAGG - Intergenic
1131103565 15:89713970-89713992 TCTCCCATGGTATGGGATCCTGG - Intronic
1134436794 16:14266937-14266959 TATCTCATGGTCTTGGATCCAGG - Intergenic
1134584468 16:15397952-15397974 TAGCACCTGTTACAGGAACCTGG + Intronic
1137817153 16:51409332-51409354 TAACACATGGTAGGGGACCCAGG + Intergenic
1140834200 16:78778352-78778374 TACCACTTGGTAAAGGAACGAGG + Intronic
1148519539 17:48258339-48258361 TTTCACATAATATAGAAACCAGG - Intronic
1156098344 18:33563174-33563196 TGTCACATTCTAGAGGAACCAGG + Intergenic
1157579788 18:48766964-48766986 TATCACATGTTTTAGGAAAAGGG + Intronic
1157690162 18:49675143-49675165 CTTCACATGGTAGAGAAACCTGG + Intergenic
1158108108 18:53907911-53907933 TATGACATGGTATGGGAAATGGG + Intergenic
1164532528 19:29059150-29059172 TATCTCAAGTTATAGGTACCAGG - Intergenic
925165440 2:1713106-1713128 GATCACCAGGTCTAGGAACCAGG - Intronic
929965314 2:46530206-46530228 TCTCACATGCTGTAGGGACCAGG - Intronic
932323163 2:70836745-70836767 TCTCACATGGTGCAGGAAGCAGG - Intergenic
934476797 2:94599121-94599143 TAGCACATGGTATTGGAATGCGG + Intronic
938777575 2:134555378-134555400 GATTACATGGTAGAGGCACCTGG + Intronic
940872807 2:158873537-158873559 TATCACAGGGTGTACGAACAGGG + Intergenic
941383882 2:164829677-164829699 TATCAAATTGTATATGAACAGGG + Intronic
947032498 2:225813156-225813178 TGTCACATGATATAGGACCTGGG - Intergenic
1173421711 20:42907000-42907022 TAACACCTGGTTTAGGCACCGGG + Intronic
1183033548 22:35123435-35123457 TTTCACTGGGTATAGGAATCTGG + Intergenic
1184279648 22:43429709-43429731 TAGCACAGGGAATAGGAAGCAGG + Intronic
950270751 3:11612966-11612988 TAGCAGATGGTATTGGAATCAGG + Intronic
950951551 3:17005181-17005203 TTTCAAATGGAATAGGAAACAGG + Intronic
959434824 3:106301702-106301724 TTATACATGGTATAGGAAGCTGG - Intergenic
959547924 3:107619704-107619726 TTTCACTGGGTATAGGATCCTGG + Intronic
967244631 3:187473448-187473470 TAAAACAAGGTAAAGGAACCAGG + Intergenic
969649313 4:8454562-8454584 TATCACAGGGTAATGGCACCTGG + Intronic
971687111 4:29784953-29784975 TGTCACATGATATAGGAAAAAGG + Intergenic
972842767 4:42950970-42950992 TATTACATGGTATAGGCTCATGG + Intronic
973247132 4:48020905-48020927 TATTACATGGAATAGAAATCTGG - Intronic
974901407 4:68003151-68003173 TTTCACAGGGTATAGGATTCAGG - Intergenic
976235497 4:82891762-82891784 TATCCCATGGTATTGAGACCCGG + Intronic
977931987 4:102759720-102759742 TACCACATAGTATAGAGACCAGG + Intronic
979151560 4:117322856-117322878 TATCACATGGATTTGGAACGGGG + Intergenic
979715416 4:123831703-123831725 TGTCACATTGTTTATGAACCAGG + Intergenic
980648705 4:135681258-135681280 TATCAAATGCCATAGGAAACAGG + Intergenic
982408618 4:155047410-155047432 AAACACATGGTCTAGAAACCAGG + Intergenic
983753170 4:171301656-171301678 TACCACATGATATAGTAGCCTGG + Intergenic
989299738 5:39876641-39876663 TTTCACATGGTAGAGGAGCAAGG + Intergenic
996763618 5:127012117-127012139 AATCACATGGTATAGCAAGTAGG - Intronic
997688025 5:135802400-135802422 TATCACAAGGTATATGCACATGG - Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
999575838 5:152975666-152975688 GAGCACATGGTATAGGAAAATGG - Intergenic
999932892 5:156453227-156453249 TGTCACATGGAAGAGGAAACAGG + Intronic
1001767053 5:174258176-174258198 AAACACTTGGTATAGGAACATGG - Intergenic
1002833660 6:847047-847069 CATCACATGGTATAGAAAGCAGG + Intergenic
1010580394 6:77589518-77589540 GGTCACATGGTATGGCAACCTGG + Intergenic
1015690964 6:135922271-135922293 TATCAAATGGCATGGGAACCAGG + Intronic
1016508002 6:144805920-144805942 TATCAGATTGTATAGAACCCTGG + Intronic
1017474992 6:154781495-154781517 TTTCACATGGAATAGGAAAAGGG + Intronic
1023029341 7:36079129-36079151 TTTCACATGGTACAGGCCCCAGG + Exonic
1023195500 7:37634414-37634436 TATCACTGGGTATAGGATTCTGG + Intergenic
1025145779 7:56501967-56501989 TTTCACATGGTATAGTACCCTGG - Intergenic
1026733337 7:72930643-72930665 TATCGCATAGTATAGGGAACAGG + Intronic
1027466824 7:78525324-78525346 TATCTCATTGCATAAGAACCAGG + Intronic
1028885689 7:95930123-95930145 TATCACATGGTCTGGGAAAATGG - Intronic
1030872960 7:114780355-114780377 TATCAGATGGCAGAGGAATCTGG + Intergenic
1031219183 7:118942497-118942519 TATCACATGGAATTGTAACCAGG - Intergenic
1033884736 7:145931631-145931653 AACCACATGATATAGGAATCTGG - Intergenic
1042805561 8:72767183-72767205 TATCACATGGTATATCCACCAGG + Intronic
1043413567 8:80025803-80025825 TAGTAAATGGTAGAGGAACCAGG + Intronic
1043826532 8:84936313-84936335 TATCAGATGGTATCAGAAGCAGG + Intergenic
1044632862 8:94296279-94296301 TATCACATGATAAAGGAAAAAGG + Intergenic
1045311642 8:101008245-101008267 GGTCACATGGTTTAAGAACCTGG + Intergenic
1047590304 8:126320115-126320137 TATCACATGGCAAAGGAGCTGGG - Intergenic
1048008022 8:130434821-130434843 TATCACATGAGACAGGAAGCAGG + Intronic
1052538077 9:29773411-29773433 TATCAGATTGTCTAGGAACCTGG + Intergenic
1052853229 9:33390788-33390810 TAGCACATGGTATTGGAATGGGG - Intronic
1053047571 9:34932511-34932533 TATCCCATGGACTAGGTACCTGG + Intergenic
1053099604 9:35360246-35360268 TGTCACATGTGATAGGAACTTGG - Intronic
1053539631 9:38959841-38959863 TATCACATTTTATAGGAAAATGG - Intergenic
1053681268 9:40486956-40486978 TAGCACATGGTATTGGAATGCGG - Intergenic
1054282446 9:63137978-63138000 TAGCACATGGTATTGGAATGCGG + Intergenic
1054294355 9:63322472-63322494 TAGCACATGGTATTGGAATGCGG - Intergenic
1054392377 9:64626960-64626982 TAGCACATGGTATTGGAATGCGG - Intergenic
1054427025 9:65132170-65132192 TAGCACATGGTATTGGAATGCGG - Intergenic
1054503350 9:65889370-65889392 TAGCACATGGTATTGGAATGCGG + Intronic
1054626510 9:67404077-67404099 TATCACATTTTATAGGAAAATGG + Intergenic
1055055854 9:72023332-72023354 TCTCACCTGGTCTAGGAACAAGG - Intergenic
1057401986 9:94731621-94731643 TATCACATAGCACAGAAACCAGG - Intronic
1203792088 EBV:157210-157232 TAGCACATGGTCTCGGAGCCAGG + Intergenic
1187545784 X:20251058-20251080 TGTCACTTGGTATAGAAATCTGG + Intronic
1188910619 X:35842725-35842747 AATAACATGGGATAGGAACTAGG + Intergenic
1189172354 X:38921947-38921969 TAGCACATGGAAAAGTAACCAGG - Intergenic
1192036334 X:67566970-67566992 GATCACATAGTATAGTAACTTGG + Intronic
1192536035 X:71928619-71928641 TACCATATGGTATAGAAGCCTGG + Intergenic
1193709310 X:84860276-84860298 TAAAACATGGTAAAGGAATCAGG - Intergenic
1194147845 X:90284831-90284853 TAAAACAAGGTAAAGGAACCAGG + Intergenic
1196543794 X:116938999-116939021 TAAAACAAGGTAAAGGAACCAGG - Intergenic
1196740362 X:119019774-119019796 GACCACATGGTCTGGGAACCAGG - Intergenic
1197810138 X:130434019-130434041 TATCAGATGGTATAAGAGCTAGG + Intergenic
1200494229 Y:3861592-3861614 TAAAACAAGGTAAAGGAACCAGG + Intergenic