ID: 1087671201

View in Genome Browser
Species Human (GRCh38)
Location 11:101109046-101109068
Sequence TCTTACATGGGCAAGGTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 4, 2: 52, 3: 144, 4: 439}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087671201_1087671205 27 Left 1087671201 11:101109046-101109068 CCACAAACCTTGCCCATGTAAGA 0: 1
1: 4
2: 52
3: 144
4: 439
Right 1087671205 11:101109096-101109118 GTTCAGACTGCTCCACCAATTGG 0: 1
1: 7
2: 79
3: 158
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087671201 Original CRISPR TCTTACATGGGCAAGGTTTG TGG (reversed) Intronic
901261117 1:7871783-7871805 TCTTATATGGGCACTGTTTGTGG - Intergenic
901751034 1:11408806-11408828 TCTTCTATGGGCACAGTTTGTGG - Intergenic
902165441 1:14567511-14567533 TTTTACAAGTTCAAGGTTTGTGG - Intergenic
902928284 1:19712240-19712262 TCTTATATGGACAATGTTTGTGG + Intronic
903636112 1:24817969-24817991 TCTTATATGGGTGTGGTTTGTGG + Intronic
903881121 1:26510190-26510212 TCTTATATGGGCACAGTTTGTGG - Intergenic
904680947 1:32228800-32228822 TCTTACATGGTCATAGTTGGGGG - Exonic
904761294 1:32806151-32806173 TCTTATACGGGCACAGTTTGTGG + Intronic
905086213 1:35379884-35379906 TCTTACATTGACGTGGTTTGTGG + Intronic
907633162 1:56105563-56105585 TCTTATATGGGTATGGTTTGTGG + Intergenic
907666727 1:56439512-56439534 TCTTAGAGTGGCAAGCTTTGGGG - Intergenic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909139660 1:71847568-71847590 TCTTACATGGGCACTGCTTTTGG - Intronic
909550541 1:76894776-76894798 AATTACATGAGTAAGGTTTGGGG + Intronic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
909844041 1:80367981-80368003 TCTTATGTGGGCATGGCTTGTGG - Intergenic
909888992 1:80979380-80979402 TCTTATATAGGCAGAGTTTGTGG + Intergenic
910078458 1:83309255-83309277 TCTTATGTGAGCATGGTTTGTGG + Intergenic
910997033 1:93116940-93116962 TCTTAGGTGGGCACGGTTTTTGG + Intronic
911173509 1:94795466-94795488 TCTTAAATTGGCATGGTTTTAGG + Intergenic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
911968538 1:104399291-104399313 TGTTACATGGGCATACTTTGTGG + Intergenic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
914436161 1:147661411-147661433 TCTTATATGGGGGCGGTTTGTGG - Intronic
915305614 1:154975748-154975770 TCTTCCCTGGGCTTGGTTTGGGG + Intronic
915660914 1:157404165-157404187 TCTTACATGGCCAAAGATGGAGG + Intergenic
916956896 1:169847107-169847129 TCTTATAGGGGCACAGTTTGTGG + Intronic
917192301 1:172430951-172430973 TCTTATATGGGTATAGTTTGTGG - Intronic
917353277 1:174100698-174100720 TCTTACATAGTCATGGTTTGTGG + Intergenic
918392092 1:184076343-184076365 TCTTATATGGGCACAATTTGTGG - Intergenic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919113295 1:193247301-193247323 TCTTATATGGGTGTGGTTTGTGG - Intronic
919123419 1:193368827-193368849 TCTTATACTGGCATGGTTTGTGG + Intergenic
919847477 1:201650718-201650740 TCTGACAGGGGCAAGGATTTGGG + Intronic
920538364 1:206757409-206757431 TCTTATATGGACACAGTTTGTGG + Intergenic
920799197 1:209172038-209172060 TCTTACATGGGCACAGTTCATGG - Intergenic
921276209 1:213523240-213523262 TCTTACATGGGCACAGTTTGTGG + Intergenic
921576448 1:216840825-216840847 TCTTATATGGGTATGGTTTGTGG + Intronic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
922903145 1:229153912-229153934 TCTTATATGGACATGGTTTGCGG + Intergenic
923131439 1:231078238-231078260 TTTTAGATGGGAAAAGTTTGAGG - Intergenic
923481317 1:234386970-234386992 TCTTACATGGGTACAGTTTGTGG + Intergenic
924079183 1:240375143-240375165 TCTTATGTGGGCATAGTTTGTGG + Intronic
924689442 1:246331898-246331920 TCTTATATGGGGATGGTTTGTGG - Intronic
1062777233 10:162235-162257 TCTTACATAGGTGTGGTTTGTGG + Intronic
1063329483 10:5142692-5142714 TCTTATATGGGCACAGTTTAGGG + Intergenic
1063675684 10:8139265-8139287 TTTCACCTGGGCAAGGTTTGGGG + Intergenic
1063788543 10:9412757-9412779 TCTTTTATGGGCATGGTTCGTGG - Intergenic
1064211018 10:13360504-13360526 TCTTCCAAGGGCAAGGGTTTTGG + Intergenic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1065410903 10:25426639-25426661 TCTTACATGGGTGAGGTTCATGG + Intronic
1066237935 10:33505133-33505155 TCTTAGATGGGCACAGTTTGTGG + Intergenic
1068243940 10:54340726-54340748 TTCTACATTGGCATGGTTTGGGG + Intronic
1068952979 10:62795921-62795943 TCATACATTGGCATGGTTCGGGG + Intergenic
1070360816 10:75686972-75686994 TCTTATATGGGTAAGGTTCATGG - Intronic
1070955273 10:80459575-80459597 TCCTGCATGGGTAAGGTTTGGGG + Intronic
1071400847 10:85269056-85269078 TCTTACATGGGTACAGTTTGTGG + Intergenic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1073681493 10:105708999-105709021 TCTTACATGTGTGAGGTTTGTGG - Intergenic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1074148821 10:110740421-110740443 TGTTTCATGGGCAAGGGTGGGGG + Intronic
1076095400 10:127731180-127731202 TCTTATATGGGCACGGTTCATGG + Intergenic
1076311223 10:129508930-129508952 TCTGTCATGAACAAGGTTTGTGG + Intronic
1076856891 10:133121085-133121107 TCTTATACGGGCGTGGTTTGTGG + Intronic
1077375005 11:2201643-2201665 TCTGACATTGGTAAGGATTGGGG - Intergenic
1077429182 11:2507565-2507587 TCTGACATGGGTCAGGGTTGGGG + Intronic
1078193672 11:9115968-9115990 GCTTACATAGGCATGGTTTGTGG + Intronic
1078243260 11:9549978-9550000 TCTTGTATGGGCACGGTTTGTGG - Intergenic
1079228414 11:18628211-18628233 TTTTATATAGGCAAGGTCTGGGG - Intronic
1079272452 11:19001004-19001026 TCTTTTATGGGCATAGTTTGTGG - Intergenic
1079343387 11:19631450-19631472 TCTTACATGGGCATTTTATGAGG - Intronic
1079451645 11:20603952-20603974 CCTTACAGGTTCAAGGTTTGGGG + Intronic
1080359133 11:31492819-31492841 TCTTACATGGGCACGGTTTCTGG + Intronic
1080842342 11:35996368-35996390 TCTTATATGGGTGTGGTTTGAGG + Intronic
1081225153 11:40512597-40512619 TGTTACATGGGTAAGGAATGAGG - Intronic
1081261551 11:40967660-40967682 TCTTATATGGGCATGATTTGTGG - Intronic
1081266171 11:41024998-41025020 TCTTATAAGGGCTTGGTTTGTGG - Intronic
1081485743 11:43526853-43526875 TCTTATATGGGCACAGTTCGTGG + Intergenic
1084369222 11:68727932-68727954 TCTTACATGGACATGGCTCGTGG - Intronic
1085436516 11:76509019-76509041 TCTTACACGAGCATGGTTTGTGG + Intronic
1085500508 11:77018286-77018308 TCTTCTATGTGCATGGTTTGTGG - Intronic
1085817508 11:79755865-79755887 ACTCAGATGGGCAAGGCTTGGGG - Intergenic
1087339858 11:96890244-96890266 TCTTACGTGGGAACAGTTTGTGG + Intergenic
1087421933 11:97940046-97940068 TCTTTTATGGGCATGATTTGTGG - Intergenic
1087609444 11:100416119-100416141 TCTTACACGGGCTTTGTTTGTGG + Intergenic
1087671201 11:101109046-101109068 TCTTACATGGGCAAGGTTTGTGG - Intronic
1087811730 11:102615797-102615819 CCTTACATGTGCAAGGCCTGGGG + Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1087951073 11:104220803-104220825 TCTTACATGGCCAAAGAATGAGG + Intergenic
1088389492 11:109298444-109298466 TCTTACATGGGCATGGTTGGTGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1089936731 11:122371897-122371919 TATTACATGAGGAAGGTTAGTGG - Intergenic
1090147777 11:124345016-124345038 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1090818655 11:130320523-130320545 TCTTACATGGGTGCAGTTTGTGG + Intergenic
1091036584 11:132239386-132239408 TATTACCTGGGCTAGGTTTATGG - Intronic
1091136159 11:133191891-133191913 TTTTAAATGGGCAAGGCTTTTGG + Intronic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1091597358 12:1886980-1887002 GCTCACAGGGGAAAGGTTTGCGG - Intronic
1091865186 12:3828019-3828041 TGTTATATGGGCATGTTTTGGGG - Intronic
1092623648 12:10302012-10302034 TCTTATATGGGCATGGTTCCTGG + Intergenic
1094250416 12:28353683-28353705 TCTGATATGGGCATGGTTTGTGG + Intronic
1095168747 12:39007618-39007640 TCTTATATAGGCACGGCTTGTGG - Intergenic
1095523075 12:43091578-43091600 TCTTATATGAGCATAGTTTGTGG - Intergenic
1095573718 12:43710623-43710645 GCTCACAGTGGCAAGGTTTGTGG + Intergenic
1097206509 12:57326064-57326086 TCTTACATGGGCACAGTTCCTGG - Intronic
1098344425 12:69486385-69486407 TCCTATATGGGCACAGTTTGAGG - Intronic
1098427399 12:70380289-70380311 CCTCATATGGGCATGGTTTGTGG + Intronic
1098800728 12:74953985-74954007 TCTTATATGGGCATGTTTTCTGG + Intergenic
1099252522 12:80273929-80273951 TCTTATATGGGCACCATTTGTGG - Intronic
1099937933 12:89150414-89150436 TCTTACGTGGGCATGGTTTGTGG - Intergenic
1100516446 12:95332860-95332882 TTTTATATGGGCTTGGTTTGTGG + Intergenic
1101872347 12:108576467-108576489 TCTTACATGGGCACAGTTCGTGG + Intergenic
1101934972 12:109049937-109049959 TTTTACAAGTTCAAGGTTTGTGG - Intronic
1103048118 12:117755493-117755515 TGTCATATGGGCACGGTTTGTGG - Intronic
1103316905 12:120063589-120063611 TTTTACTTGTGCAAGTTTTGGGG - Intronic
1104096522 12:125563063-125563085 TCTCACATAGGCATCGTTTGTGG + Intronic
1104122254 12:125810673-125810695 TCTTACCTGGGCACAGATTGTGG - Intergenic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1104949932 12:132435144-132435166 TCTTATATGGGGACAGTTTGTGG + Intergenic
1105356109 13:19661396-19661418 TTTTACAAAGGGAAGGTTTGTGG - Intronic
1105393001 13:19999452-19999474 TCTCATATGGGTATGGTTTGTGG - Intronic
1106075640 13:26458682-26458704 TCTTAGATTGGCAAGCTTTGGGG + Intergenic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1109131266 13:58589167-58589189 TCTTAAATGGGTATGGTTTATGG - Intergenic
1109254706 13:60065019-60065041 TCTAACATGGGTGTGGTTTGTGG + Intronic
1109735411 13:66478185-66478207 TCTAATATGGGCATGGCTTGTGG - Intronic
1109815633 13:67579551-67579573 TCTTATATAGACATGGTTTGTGG + Intergenic
1109853886 13:68103396-68103418 TCTTATATGGGTATGGATTGTGG + Intergenic
1109953251 13:69530410-69530432 TTTTATATGGTCATGGTTTGTGG - Intergenic
1110022023 13:70486875-70486897 TCTTACATTGCCATGGTTTGTGG + Intergenic
1110091216 13:71450387-71450409 TCTTATATGGGCATAGTTCGTGG - Intronic
1110279708 13:73678855-73678877 TCTTACAAGGGCAATATTTGTGG + Intergenic
1110766480 13:79285069-79285091 CCTTACATGGGTGTGGTTTGTGG - Intergenic
1110946785 13:81431455-81431477 TCTTATATTGGCACAGTTTGTGG - Intergenic
1111220148 13:85194367-85194389 TCTTATATGGGCACGGTTCCTGG - Intergenic
1111276937 13:85962444-85962466 TCTTACTTGGACAAGGTGTATGG - Intergenic
1111305214 13:86402769-86402791 TCTCACAGGAACAAGGTTTGGGG - Intergenic
1111324240 13:86670808-86670830 TCTTATATGGGCATGGTTCGTGG + Intergenic
1111860825 13:93703490-93703512 TTTTACATAGTTAAGGTTTGTGG - Intronic
1111936641 13:94564462-94564484 TCTTACATGGGCATGATATGCGG + Intergenic
1112543864 13:100344963-100344985 CCTTACACGTGCATGGTTTGTGG - Intronic
1112556245 13:100471263-100471285 TCGTACATGGGCACAGTTTGTGG + Intronic
1112646505 13:101339222-101339244 TCATACAGTGGTAAGGTTTGGGG - Intronic
1112728795 13:102335905-102335927 TCTTACATGGGCACAGTTTGGGG - Intronic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1113695023 13:112339153-112339175 TCTTATATGGGCACTGTTTGTGG - Intergenic
1114152465 14:20059163-20059185 TTCTACATGGGCACGGCTTGTGG + Intergenic
1115050960 14:29062296-29062318 TCTTAGGAGGGCTAGGTTTGAGG - Intergenic
1115379156 14:32714168-32714190 TCTTATATGGGTGTGGTTTGTGG + Intronic
1115423436 14:33224726-33224748 TCTAACATGAGCTAGATTTGTGG - Intronic
1115486796 14:33918224-33918246 TCTTATATGGGCACAGTTTTTGG - Intergenic
1116446790 14:45020782-45020804 TTTTACACGGGTGAGGTTTGAGG + Intronic
1116939354 14:50774952-50774974 TCTTACATGGACCAGGTCTTTGG + Intronic
1117231239 14:53720975-53720997 TCTTATATGGGCACAGTTCGTGG - Intergenic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1118260603 14:64243259-64243281 GCTTATATGGGCATAGTTTGTGG + Intronic
1118553169 14:66980016-66980038 TCTTACATGGGCACCATTTGTGG + Intronic
1118657960 14:67973684-67973706 TCTTACATTGAAAATGTTTGTGG - Intronic
1120174986 14:81284025-81284047 TCTTATATGGGCACAGTTTATGG - Intronic
1120264678 14:82233912-82233934 TTTTATATGGGCATGGTTTCTGG - Intergenic
1120318715 14:82931169-82931191 TCTTATTTGGGCATGGTTTCTGG + Intergenic
1121036358 14:90707240-90707262 TCTTAGGTGGGCATGGTTTGTGG - Intronic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1123013829 14:105364000-105364022 TCTTACATGGGTGATGTTCGTGG + Intronic
1124461003 15:29891716-29891738 TCTTATATGGGCAGGGTTTGTGG - Intronic
1125313606 15:38407609-38407631 TTTTACATGCGAATGGTTTGGGG - Intergenic
1125810477 15:42536090-42536112 TCTTATATTGGCATGGTTTGTGG + Intronic
1126885920 15:53149944-53149966 TCTTACATGAACATGATTTGTGG - Intergenic
1127025441 15:54800156-54800178 TCTTATATAGGCAAGGTTCGTGG - Intergenic
1128722566 15:69961509-69961531 CCTTACATAGGTGAGGTTTGTGG - Intergenic
1129126446 15:73445763-73445785 TCTTCTATGGGCATGGTTTGTGG + Intronic
1129289156 15:74550156-74550178 TGTCACTTGGGAAAGGTTTGGGG + Intronic
1129326232 15:74801611-74801633 TCTTGGATGGGTAGGGTTTGAGG + Intronic
1129948813 15:79567318-79567340 TCTTAGATGGGCATGGCTTGTGG - Intergenic
1130290444 15:82594942-82594964 TCTTACATGGGAATGGTTTGTGG + Intronic
1130408158 15:83621493-83621515 TCTTATATAGGCATTGTTTGTGG + Intergenic
1130715051 15:86325378-86325400 TCTTAAATGGGTAACTTTTGAGG + Intronic
1131626022 15:94121858-94121880 TCTTCTATGGGCATGGCTTGTGG - Intergenic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1132032414 15:98449623-98449645 ACTTACACGGGCATGGTTTGTGG + Intronic
1133512993 16:6478804-6478826 TCTTATATGGGCACAGTTTTTGG + Intronic
1134272994 16:12750528-12750550 CCTTAAATGGACATGGTTTGTGG + Intronic
1136025586 16:27466388-27466410 TCTTATGTGGGCATGGTTTGTGG - Intronic
1136501538 16:30672466-30672488 TCTTACATGGGCACTGTTTGTGG + Intergenic
1137500074 16:49004102-49004124 CCTTACATGGTCACGGTTTCTGG + Intergenic
1137740374 16:50765350-50765372 TCTTATATGGGTGTGGTTTGTGG - Intronic
1138518375 16:57553027-57553049 TCTTATATGGGCGCAGTTTGTGG + Intronic
1139014005 16:62668027-62668049 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1139125900 16:64077031-64077053 TCTTATATGGGCACAGTTTGTGG - Intergenic
1140734104 16:77882898-77882920 TCTTACCTGGCAAGGGTTTGTGG - Intronic
1140769662 16:78191659-78191681 TCCCACATGGGGAAGGTTTTGGG + Intronic
1141292323 16:82730490-82730512 TCTTGTATGGGCATGGTTTGTGG + Intronic
1141304465 16:82848598-82848620 TCTTATATGGGCACAGTTTGTGG - Intronic
1142922732 17:3205213-3205235 TCTTATATGGGCATGATTTGTGG - Intergenic
1143184949 17:5004449-5004471 TCTTACAGGGTCATGGTCTGAGG - Intronic
1144265661 17:13566296-13566318 TCTTCTATGGGCGTGGTTTGAGG - Intronic
1146412710 17:32601446-32601468 TCCTACATGGGTACAGTTTGTGG + Intronic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1149972050 17:61228656-61228678 TTTTACATGGGCATAGCTTGAGG - Intronic
1150916566 17:69443627-69443649 TCTTACTAGGGCAAGGATTAGGG - Intronic
1150947972 17:69767772-69767794 TCTTAGAGGGGCACAGTTTGTGG - Intergenic
1151027414 17:70694865-70694887 TCTTACATGGGTAGGGTTTGTGG - Intergenic
1151410744 17:73926541-73926563 TCTTTTATGGGCACAGTTTGTGG - Intergenic
1152978963 18:254778-254800 TCTTAGATGGGCACAGTTTGTGG - Intronic
1153292810 18:3518301-3518323 TCTTATATGGGCACGGTTCATGG + Intronic
1153405051 18:4728577-4728599 TCTAAAATGGGAAAGTTTTGGGG - Intergenic
1153467324 18:5403129-5403151 TCTGTCATGGGAAAGGTCTGTGG + Intronic
1153696494 18:7648196-7648218 TCTTATATGGGCACGGTTCATGG - Intronic
1154341642 18:13507681-13507703 TCTTATATGGGTATGGTTTGTGG - Intronic
1155023854 18:21922785-21922807 TCTGACATGGGACAGGCTTGGGG + Intergenic
1155101584 18:22615754-22615776 TCATACATGGGTGCGGTTTGTGG - Intergenic
1155266176 18:24096021-24096043 TCTTATGTGGGCATGGTTTGTGG + Intronic
1155741197 18:29290327-29290349 TCTTATATGGGCAAGGTTTCTGG - Intergenic
1155809958 18:30219821-30219843 TCTTATATGGGCACAGTTTGTGG + Intergenic
1156110625 18:33722035-33722057 TCTTATGAGGGCATGGTTTGTGG - Intronic
1156131013 18:33974537-33974559 TCTTATATGGGAGAAGTTTGTGG + Intronic
1157371853 18:47120895-47120917 CTTAACATGGGCATGGTTTGTGG + Intronic
1158194974 18:54874850-54874872 TTTTACATGAGCAAGTTTAGGGG + Intronic
1159332133 18:67009447-67009469 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1159695119 18:71547317-71547339 TCTTACATGGGCGTGGTTTGTGG + Intergenic
1159700536 18:71621162-71621184 TGTTACATGGGTGTGGTTTGTGG + Intergenic
1159906275 18:74095560-74095582 TCTTACATGGGCACTGTCTGAGG + Intronic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
1160166218 18:76514765-76514787 TCCTATATGGGCGTGGTTTGTGG + Intergenic
1160358960 18:78254175-78254197 ACTTGCTTGGGCAAGGTTTTAGG + Intergenic
1160520304 18:79504470-79504492 TCTTAGATGGGCACAGTTCGTGG + Intronic
1161058325 19:2201478-2201500 TCCCCCATGGGCAGGGTTTGGGG + Intronic
1163135318 19:15306778-15306800 TCTTAGATGGACATGGTTTGTGG + Intronic
1165644432 19:37422376-37422398 TCTTACATGGATGAAGTTTGTGG + Intronic
1166021369 19:40033085-40033107 TCTTTTATGGGCAGGATTTGTGG + Exonic
1166392181 19:42414817-42414839 TCTTACGTGGACATGGTTGGTGG - Intronic
1166776036 19:45313334-45313356 TTTTATATGGGCAAGGTCGGTGG - Intronic
1167397590 19:49241389-49241411 TTTTATATGGGCATAGTTTGTGG + Intergenic
1167603818 19:50469403-50469425 TGTTAGATGGGCAAGGCCTGTGG - Intronic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
925462392 2:4074707-4074729 TTTTCCATGGGCAGGGGTTGGGG - Intergenic
925644385 2:6021002-6021024 TCTTACATGGCCAAGGCAGGAGG - Intergenic
925871453 2:8275058-8275080 TCTTATATGGGCCTGGTTTGTGG + Intergenic
925954271 2:8946731-8946753 TCTTATGTGGGCACAGTTTGTGG - Intronic
926834842 2:17007067-17007089 TCTTATATAGGCATGGTTTCTGG - Intergenic
927299057 2:21489616-21489638 TCTTTTATGGGTGAGGTTTGCGG + Intergenic
927731323 2:25474913-25474935 TCTTATGTGGGCATGGTTTGTGG - Intronic
928264021 2:29794742-29794764 CCTTATAGGGGCATGGTTTGTGG + Intronic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
929529771 2:42741738-42741760 TCTTATATGGGCATGGCTTGTGG + Intronic
929924575 2:46197717-46197739 TCTGACAAGGTCAAGGTTAGAGG - Intergenic
930831332 2:55746724-55746746 TCTTACATGGGCATGATTTATGG - Intergenic
931279617 2:60777855-60777877 TCTTATATGGGCTCAGTTTGTGG + Intronic
932116756 2:69057530-69057552 TCTTACATGTGTGTGGTTTGTGG - Intronic
933160345 2:79016925-79016947 TCTCACATGGGGGAGGTTTGTGG - Intergenic
934548235 2:95236983-95237005 TCTTACAAATGGAAGGTTTGTGG + Intronic
934718544 2:96557284-96557306 TCCCACATGAGCAAGGGTTGTGG + Intergenic
935729883 2:106056491-106056513 TCTTTCATGGGCAAAGGTTAGGG + Intergenic
935746679 2:106194845-106194867 TTTTACTTCGGCAAGGTTTAGGG - Intergenic
936920170 2:117680467-117680489 TCTTATATGGGTATGGTTGGAGG - Intergenic
937067178 2:119026235-119026257 TCTTACGTGAGCTAAGTTTGGGG + Intergenic
937174027 2:119908491-119908513 TCTTATATGGGTGTGGTTTGTGG - Intronic
938022554 2:127917933-127917955 TCTTATATGGGCACAGTTGGTGG + Intergenic
938174189 2:129109248-129109270 CCTTATATGGGCATGATTTGTGG + Intergenic
938423884 2:131167987-131168009 TCTTATATGGGTGTGGTTTGTGG - Intronic
938562556 2:132487157-132487179 TCTTATATGGGTATGGTTTGTGG + Intronic
938621305 2:133057099-133057121 TCTTATATGGGCACGATTTGTGG - Intronic
938987237 2:136589290-136589312 TCTCATATAGGCATGGTTTGTGG + Intergenic
939569303 2:143821635-143821657 TCTTACATGTGTAGGTTTTGGGG + Intergenic
939722739 2:145675200-145675222 TCTTAAATGGGCACGGTTTGTGG + Intergenic
939867783 2:147493638-147493660 TCTTATGTGGGCACGGTTTGTGG - Intergenic
940646764 2:156400134-156400156 CCTTACATAAGCAAGGTATGGGG + Intergenic
941016426 2:160362565-160362587 TCCTATATGGGAATGGTTTGTGG + Intronic
941077465 2:161022171-161022193 TCTTTTATGGGCATGGTGTGTGG - Intergenic
941433877 2:165444329-165444351 TCTTCCATGGGCATGGTTTGTGG - Intergenic
942150568 2:173072487-173072509 TCTTAAAGGGGCAAAGATTGGGG - Intergenic
942876851 2:180810840-180810862 TCTTATATGGGCAAGGTTTGTGG - Intergenic
943695112 2:190918933-190918955 TCTTATATGGACATGGCTTGTGG + Intronic
944623034 2:201538629-201538651 TCTTAGATGGGTGTGGTTTGTGG - Intronic
945830211 2:214775435-214775457 TGTTACATGGCCAGGGTTTGTGG + Intronic
946524207 2:220500630-220500652 TCTTATATTGGCACAGTTTGGGG - Intergenic
946853209 2:223928044-223928066 TCTTATGTGGGCACAGTTTGTGG + Intronic
947020737 2:225672878-225672900 TCTTATATGGGCATGGTTCGTGG + Intergenic
947165115 2:227253817-227253839 TATTACATGGGGAAGATCTGAGG + Intronic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
1169322206 20:4642506-4642528 TCTTATGTGGGTATGGTTTGTGG - Intergenic
1171145931 20:22782676-22782698 TCTTATATGGGCACGGTTCATGG - Intergenic
1171313163 20:24162417-24162439 TCTCACATGGGTGTGGTTTGTGG - Intergenic
1172257763 20:33534814-33534836 TCTTATATGGGCACAGTTTGTGG + Intronic
1173942087 20:46920033-46920055 TCTTATATGGGCACAGTTTGTGG + Intronic
1174650527 20:52121023-52121045 TCTTACATGGGCACAGTTCATGG - Intronic
1174692545 20:52521973-52521995 CCTTATATGGACATGGTTTGTGG + Intergenic
1176311345 21:5152176-5152198 TCTTACATGGGCACGGATCACGG + Intronic
1176372221 21:6068964-6068986 TCTAACCTTGGCCAGGTTTGGGG + Intergenic
1177335717 21:19723465-19723487 GCTTATATGGGCATGGTTTGTGG + Intergenic
1177654639 21:24002184-24002206 TCTTATATGGGCACAGTTTGTGG - Intergenic
1178070661 21:28962484-28962506 TCTTATATGGCAATGGTTTGTGG - Intronic
1178100546 21:29264129-29264151 TCTTATATGGGCGGGGTTTGTGG + Intronic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1179751298 21:43469575-43469597 TCTAACCTTGGCCAGGTTTGGGG - Intergenic
1179845705 21:44109859-44109881 TCTTACATGGGCACGGATCACGG - Intronic
1180113274 21:45676577-45676599 TCTTATATGGGCAAAGTTCATGG - Intronic
1180878980 22:19190390-19190412 TCTTATAGGGGCATGGTTTGTGG + Intronic
1181392800 22:22595667-22595689 TCTGACATGGGCAAACTTTTGGG - Intergenic
1183664944 22:39241867-39241889 TCACAGATGGGTAAGGTTTGAGG + Intronic
1183811103 22:40258149-40258171 TCTTCCAGAGGAAAGGTTTGTGG - Intronic
1185084321 22:48730716-48730738 TCTTACACGGGCATGGTTTGTGG - Intronic
1185120443 22:48963778-48963800 ACTTACTTGGCCAAGCTTTGAGG - Intergenic
949317817 3:2776174-2776196 TCTTATATTGGCAAGGTCTGGGG + Intronic
949626410 3:5871737-5871759 TCTTACATGGGCACGGTTTGTGG - Intergenic
949724410 3:7026645-7026667 TCTTACATGGGTAAAATTTCTGG - Intronic
949813554 3:8034188-8034210 CTTTATATGGGCATGGTTTGTGG + Intergenic
949838613 3:8296152-8296174 TCTCACATAGGCAATTTTTGAGG - Intergenic
950112654 3:10429508-10429530 TCTGATATGGGCATGGTTTGTGG - Intronic
950632407 3:14291514-14291536 TCTTACATGGGCACAGTTCATGG - Intergenic
951333039 3:21388168-21388190 TCTTACATGGGCACAGTTAATGG - Intergenic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
952585052 3:34882324-34882346 TGTTCCATGGGAAAGTTTTGGGG + Intergenic
952639258 3:35572409-35572431 TCTTATATGAGCACTGTTTGTGG - Intergenic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
954844560 3:53544361-53544383 TCACAGATGGGCAAGGTTGGGGG + Intronic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955426560 3:58796929-58796951 TCTTATATGGGCATGGTTCCTGG - Intronic
955678306 3:61472719-61472741 CCTTATATGGGCATGATTTGTGG + Intergenic
955969796 3:64426994-64427016 TCATATATGGGCAGAGTTTGTGG - Intronic
956063558 3:65373343-65373365 TCTTATGTGGGTATGGTTTGTGG + Intronic
956098223 3:65739783-65739805 TCTTATATGGGTATAGTTTGTGG + Intronic
956409564 3:68965554-68965576 TTTTACTTGGGAAAGGTTTGGGG + Intergenic
956960612 3:74395973-74395995 TCTTACATGAGCAGGGTTCATGG - Intronic
956960746 3:74397430-74397452 TCTTATATGAGCACAGTTTGTGG - Intronic
957627060 3:82666781-82666803 TCTTATATGGGCAAAGTTCCTGG + Intergenic
957782914 3:84842777-84842799 TCTTACATGGGTGTGGTTTGTGG - Intergenic
957863734 3:85994795-85994817 TCCTATATGAGCATGGTTTGTGG + Intronic
958452095 3:94286152-94286174 TCTTACAAATGGAAGGTTTGTGG + Intergenic
958698758 3:97561010-97561032 TCTTACATGGGCATTGTTCATGG - Intronic
959059436 3:101602856-101602878 TCTTACATGGGCAGAGTGGGAGG + Intergenic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
960097992 3:113706634-113706656 TCTTATATGGGCACAATTTGTGG + Intergenic
960154627 3:114286261-114286283 TCTTATATGGGCCTGGTTTGTGG + Intronic
960179853 3:114562867-114562889 TCTTATATGGGTGTGGTTTGTGG + Intronic
960476386 3:118134543-118134565 TCTTACATGGGTGAGGTTTGTGG - Intergenic
961092142 3:124122654-124122676 TTTTATATGGGCATGGTTTGTGG - Intronic
961505299 3:127367044-127367066 GCCTACAGGGGGAAGGTTTGGGG + Intergenic
963126318 3:141820212-141820234 TTTTACATAGGTGAGGTTTGAGG - Intergenic
963195217 3:142520154-142520176 TCTTATATGGGCACAGTTTGTGG - Intronic
963283932 3:143414605-143414627 TCTTTTATGGGCAATGTCTGTGG - Intronic
963573920 3:147034678-147034700 TCTCACATGAACAAGGTTTGAGG + Intergenic
963591697 3:147269241-147269263 GCTTACTGTGGCAAGGTTTGTGG - Intergenic
963608806 3:147439364-147439386 TCTTGTGTGGGCATGGTTTGTGG + Intronic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
963946524 3:151151675-151151697 TCTTATATGGGAATGGTTCGTGG + Intronic
964930176 3:162009934-162009956 TCTTATATGGACATGGTTTGTGG + Intergenic
965224176 3:165966599-165966621 TCTTATGTGAGCATGGTTTGTGG - Intergenic
965918630 3:173883360-173883382 TCTTATATGGGTGTGGTTTGTGG + Intronic
966307663 3:178555246-178555268 TTTTGCTTGGGGAAGGTTTGTGG - Intronic
966503024 3:180667564-180667586 TCTTAGAGAGGCACGGTTTGTGG - Intronic
966717385 3:183027146-183027168 TCTTACATGGGCGCAGATTGAGG - Intronic
967429372 3:189363902-189363924 TCTTACTTGGGAGAGGTTGGGGG - Intergenic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
967710797 3:192705561-192705583 TCTTATGTGGGCATGGCTTGTGG + Intronic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
970605391 4:17676327-17676349 TCTTCTACGGGCATGGTTTGTGG + Intronic
970687171 4:18581672-18581694 TGTTTCATGAGCCAGGTTTGGGG + Intergenic
971016746 4:22496871-22496893 TCTGTCATGGGCATGGTATGGGG - Intronic
971131805 4:23819446-23819468 TCTTCCATGAGCAAGAGTTGGGG - Intronic
971295557 4:25386521-25386543 TTTTATATGGCCATGGTTTGTGG + Intronic
971477907 4:27089583-27089605 TCATACATTGGCATGGTTTTGGG + Intergenic
971679865 4:29683933-29683955 TATTATATGGGCATGGTTTTTGG - Intergenic
971709065 4:30088079-30088101 TCTCATATGGGCATGGTTTGTGG + Intergenic
971825202 4:31612366-31612388 ACTTATATAAGCAAGGTTTGGGG - Intergenic
972189358 4:36571240-36571262 TCTTACATGGGTGTGGTTCGTGG + Intergenic
972383720 4:38543420-38543442 TCTTATATGAGCATGGTTGGTGG + Intergenic
973128159 4:46614818-46614840 TCTTATATGGGCCCAGTTTGTGG - Intergenic
974316227 4:60284711-60284733 TCTTATATGGGCACAGTTTGTGG - Intergenic
974381511 4:61146493-61146515 TCTTCCATGGAGAAGGCTTGTGG - Intergenic
974423336 4:61707153-61707175 TCTTATATAGGCATGGTTCGTGG + Intronic
974997018 4:69174152-69174174 TCTTATATGGGCGTGGATTGTGG - Intronic
975008033 4:69314634-69314656 TCTTATATGGGCGTGGATTGTGG + Intronic
975567884 4:75779095-75779117 TCTTATATGGGCACTGTTTGTGG - Intronic
975762056 4:77630302-77630324 TCTTATATGGGTACAGTTTGTGG + Intergenic
975880103 4:78895007-78895029 TCTTATATGGGCTCAGTTTGTGG + Intronic
976154457 4:82127602-82127624 TCTTATATGGGCTAGGTTCCTGG - Intergenic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977356059 4:95948320-95948342 TCTTATATGGGCACAGTTTGTGG + Intergenic
977368812 4:96107971-96107993 TCTCATATGGGCACAGTTTGTGG - Intergenic
977539320 4:98297583-98297605 TCATACATGGGCATGGTTCACGG - Intronic
977612902 4:99054866-99054888 CTTTACATGGGCACAGTTTGTGG + Intronic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978181309 4:105799617-105799639 TCTTAAGTGGGCATGGTTCGTGG + Intronic
978249424 4:106612240-106612262 TCTTATATGGGAGTGGTTTGTGG + Intergenic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979648626 4:123104289-123104311 TCTTACATGGGTGTGGTTTATGG - Intronic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
979811560 4:125042608-125042630 TCTTACAAGGGCATGGTTCGTGG - Intergenic
980529465 4:134033225-134033247 TCTTATATGGGTGTGGTTTGTGG - Intergenic
980549720 4:134318853-134318875 TCTTATATGGGCATAGTTTGTGG + Intergenic
980952889 4:139399082-139399104 TGTTATATGGGCACAGTTTGTGG + Intronic
981200635 4:141975389-141975411 TCTTATATGGACATAGTTTGTGG - Intergenic
981493002 4:145361112-145361134 TCTTACATGGGTGTGGTTTGTGG - Intergenic
981683431 4:147426446-147426468 TCTTCTATGGGCACAGTTTGTGG - Intergenic
981764578 4:148233763-148233785 TCTTACGTGGTCATGGTTTGTGG + Intronic
981984784 4:150840575-150840597 TCTTAAATGGGTGTGGTTTGTGG + Intronic
982036182 4:151348396-151348418 TCTTATGTGGGCATGGTTTGTGG - Intergenic
982149389 4:152435945-152435967 TCTTCCATGGGTGCGGTTTGTGG - Intronic
982344650 4:154344122-154344144 TCTTTCATGGCCATGGTTTGTGG + Intronic
982575694 4:157107093-157107115 TCTTATGTGGGCATGATTTGTGG - Intronic
982833438 4:160091798-160091820 TCTTATAAGGGCAGGATTTGTGG + Intergenic
982876028 4:160651016-160651038 TCTTATATGGGTACAGTTTGTGG - Intergenic
982903108 4:161032074-161032096 TCTTATATAGGCACAGTTTGTGG + Intergenic
983061862 4:163169622-163169644 TCTTACAAGGGTAAGCTTTAAGG - Intergenic
983086710 4:163454016-163454038 TCTTATACGGGCATGGTTTGTGG + Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983808595 4:172027437-172027459 TCTTACAAGGGCACAGTTTGTGG - Intronic
984299355 4:177895098-177895120 TCTTATATGGGCACAATTTGTGG - Intronic
985955085 5:3259399-3259421 ACTTACACCGGCAAGGTATGTGG + Intergenic
986294818 5:6429265-6429287 TTTTTCATGGGCAAAGGTTGGGG - Intergenic
986682200 5:10244173-10244195 TCTTATTTGGGCATGGCTTGTGG + Intronic
986738636 5:10686129-10686151 TCTTATATGGGCACGGTTCGTGG - Intronic
986880549 5:12165153-12165175 TCTTACATGAGCACAGTTTATGG - Intergenic
987179623 5:15353850-15353872 TCCTCCATGGGCACGTTTTGGGG + Intergenic
987501952 5:18723004-18723026 TCTTACAAATTCAAGGTTTGTGG - Intergenic
987966324 5:24880584-24880606 TCTTATATGGGAGTGGTTTGTGG - Intergenic
988160427 5:27513207-27513229 TCTTATATGGGTACAGTTTGTGG - Intergenic
988431600 5:31125460-31125482 TCTTATACGGGCATGGTTCGTGG - Intergenic
988669778 5:33368912-33368934 TTTTATAGGGGCATGGTTTGTGG + Intergenic
988889109 5:35595267-35595289 TCTTATATGGGTGTGGTTTGCGG + Intergenic
990398544 5:55411062-55411084 GTTTTCATGGGCACGGTTTGAGG + Intronic
990677053 5:58198840-58198862 TCATATATGGGCACAGTTTGTGG + Intergenic
990832646 5:59976903-59976925 TCTTACATGGGCATGGTTTGTGG - Intronic
990874583 5:60469742-60469764 TCCTATATGGGCATGGTTTGTGG - Intronic
991191823 5:63883375-63883397 TCTTATATGGGCGCAGTTTGTGG + Intergenic
991394132 5:66185660-66185682 TCTTATATGGGCACGGTTTGTGG - Intergenic
991729792 5:69574475-69574497 TCTTATATGGGCGCAGTTTGTGG - Intronic
991806224 5:70429616-70429638 TCTTATATGGGCGCAGTTTGTGG - Intergenic
991865162 5:71053399-71053421 TCTTATATGGGCGCAGTTTGTGG + Intronic
992074548 5:73178957-73178979 TCTTATATGAGCAAGGTTGATGG - Intergenic
992362956 5:76061048-76061070 TCTTATATGGGCATAGTTTGTGG + Intergenic
992462770 5:76977546-76977568 TCTTCTATGGGCACAGTTTGTGG - Intronic
992538123 5:77732770-77732792 TCTTATATAGGCACAGTTTGTGG - Intronic
992918353 5:81483099-81483121 TCTTGTATGGGCACGGTTTGTGG + Intronic
993082121 5:83314742-83314764 TATTTTATGGGCATGGTTTGTGG - Intronic
993124338 5:83814090-83814112 TCTTATATGGGCACTGTTTGTGG + Intergenic
993349616 5:86832554-86832576 TTTTATATGGGCACAGTTTGTGG + Intergenic
993651097 5:90523209-90523231 TCATACATGAGCAAGGTAGGAGG + Intronic
994255809 5:97594707-97594729 TCTTGTATGGTCATGGTTTGTGG + Intergenic
994380719 5:99067841-99067863 TCTTACATGGCCAAGGCGGGAGG + Intergenic
994466992 5:100148812-100148834 TCTTATGTGGGCATGGTTTGTGG + Intergenic
994870295 5:105339490-105339512 TCTTATATGGGTACAGTTTGTGG + Intergenic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995678513 5:114690816-114690838 TCTCACATGGGTATGGTTTATGG + Intergenic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
996586612 5:125095380-125095402 TCTTATATGGGTGTGGTTTGTGG - Intergenic
996673159 5:126143287-126143309 TCTTATATGGGTATGGTTTGTGG - Intergenic
996841975 5:127856823-127856845 TCTTATATGGGTACAGTTTGTGG + Intergenic
997162904 5:131627933-131627955 TCTTACATGGGCACAGTTTGTGG - Intronic
997274305 5:132571088-132571110 TCTTATATGTGGATGGTTTGTGG + Intronic
997730842 5:136173688-136173710 TCTTTCATGGGTTAGTTTTGGGG + Intronic
998814553 5:145999708-145999730 TCTTGTATGGGCAAAGTTTGTGG + Intronic
998863646 5:146472493-146472515 TCTTACATGGGTGTGGTTTGTGG - Intronic
999856918 5:155605086-155605108 CCTTACATGGGTACAGTTTGTGG + Intergenic
1000129264 5:158279661-158279683 TCTTCTATGGGCATGGTTTGTGG - Intergenic
1000821259 5:165987190-165987212 TCTTATATGGGCATGCTTTGTGG - Intergenic
1001091338 5:168743448-168743470 TCTTTGATGGGCATGGTTCGTGG - Intronic
1001460519 5:171908926-171908948 TCTGACAAGGGCTAGGGTTGTGG + Intronic
1002813092 6:653052-653074 TCTCATATGAGCATGGTTTGTGG - Intronic
1003598781 6:7499446-7499468 TCTTATATGGGCGTGGCTTGTGG + Intergenic
1003662776 6:8078380-8078402 TCTTATATGGGCATGGCTTGTGG + Intronic
1003822875 6:9919683-9919705 CCTTATATGGGCATGGTTTATGG - Intronic
1004653815 6:17638686-17638708 TCTTAAATAGGAAATGTTTGGGG - Intronic
1004978605 6:20996580-20996602 TCTTATATGGGCGCGGTTTGTGG + Intronic
1005626369 6:27666289-27666311 TCTTACATGGTCAAGATCGGTGG + Intergenic
1005689879 6:28293716-28293738 TTTTAAACGGGCATGGTTTGTGG - Intronic
1008152267 6:47968288-47968310 TCTTACATGGGTGTGGTTTGTGG + Intronic
1008831640 6:55770891-55770913 TCTTATATGGGTAAAATTTGTGG + Intronic
1009240521 6:61180608-61180630 TCTTACATAGGTATGGTTTCTGG - Intergenic
1009431209 6:63568435-63568457 TCTTAAATGGGTACAGTTTGTGG + Intronic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1009963380 6:70551805-70551827 TCTTACATAGGCATGGTTCATGG + Intronic
1010241418 6:73619160-73619182 TCTTATATGGGGAAGGATTATGG + Intronic
1010608478 6:77921837-77921859 TCTGATATGGGCATGGTTTGTGG + Intronic
1010693143 6:78934182-78934204 TCTTATATGGGTGTGGTTTGTGG + Intronic
1010724600 6:79318995-79319017 CGTCACATGGGCATGGTTTGTGG + Intergenic
1010898469 6:81396033-81396055 GATTATATGGGCACGGTTTGTGG - Intergenic
1011218019 6:85026014-85026036 TCTTTTATGGGCACAGTTTGTGG - Intergenic
1012651442 6:101758830-101758852 TCTTACATAGGAAAGCTTTTTGG + Intronic
1012983317 6:105852256-105852278 TCTTATATGGGCACAGTTTGTGG + Intergenic
1013088826 6:106880546-106880568 TCTTACATGAGTGTGGTTTGTGG + Intergenic
1013414684 6:109914035-109914057 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1013729760 6:113151265-113151287 TCTTATATGGGCATGACTTGTGG + Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1013943575 6:115695258-115695280 TTTTATATGGGCATGGTTTGTGG - Intergenic
1014076404 6:117240445-117240467 TCTTATATAGGCATGGTTTGTGG - Intergenic
1014528296 6:122527619-122527641 TTTTATATGGGAATGGTTTGTGG + Intronic
1015433407 6:133156432-133156454 TCTTACATGGGCACAGTTTGTGG + Intergenic
1015648301 6:135421126-135421148 TCTTATATGGGTACAGTTTGTGG + Intronic
1016081599 6:139863928-139863950 TCTTATATGGGCACAGTTTGTGG - Intergenic
1016344188 6:143093877-143093899 TCTTCTATGGGTGAGGTTTGAGG + Intronic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016629824 6:146215462-146215484 TCTTGCAAGGGCAAGTTTTTTGG - Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1016946161 6:149536140-149536162 TCTTATATGGGCACAGTTTGTGG - Intronic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1017584765 6:155908784-155908806 ACTGAGATGGGGAAGGTTTGGGG + Intergenic
1017592911 6:155996365-155996387 TTGTACATGGGCAAGGGTTGTGG - Intergenic
1018250592 6:161866163-161866185 TCTTATTTGGGCATGGTTTTTGG + Intronic
1018385192 6:163296608-163296630 TTTTACATGGAGAATGTTTGGGG + Intronic
1019159495 6:170059606-170059628 TCTTACATGGATGTGGTTTGTGG - Intergenic
1019892391 7:3956658-3956680 TGTGGCATGGGCAAGGTCTGGGG - Intronic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020944540 7:14585862-14585884 TCTTACATGGGCGTGGTTCATGG - Intronic
1021237178 7:18156312-18156334 TATTTCATGGGCAAGGTCTGGGG + Intronic
1022594537 7:31699871-31699893 TCTTATATGGGCGAGGTCTGTGG - Intronic
1022613941 7:31909159-31909181 TCTTACGTGGTAAAGGGTTGTGG + Intronic
1022951366 7:35341348-35341370 TCTTATATGGGCACAGTTTGTGG - Intergenic
1023193494 7:37609242-37609264 TTGTACATGAGCATGGTTTGTGG - Intergenic
1024133292 7:46379394-46379416 TCTTATGTGGGCATGGCTTGTGG - Intergenic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1026092686 7:67314675-67314697 TCTTATATGGGCATGGTTCGTGG + Intergenic
1026482770 7:70792960-70792982 TCTTACACGGGCTGGGTTCGAGG - Exonic
1027296240 7:76774523-76774545 TCTTATGTGAGCATGGTTTGTGG + Intergenic
1027908871 7:84221724-84221746 TCTTACATAGGCATAGTTTATGG + Intronic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1029378124 7:100194452-100194474 TCTTATATGGGCACGGTTTGTGG + Intronic
1029870073 7:103681100-103681122 TCTTTCATAGACAAGCTTTGAGG + Intronic
1029995742 7:105006311-105006333 ACCTACATGGGCAGAGTTTGTGG + Intergenic
1030479130 7:110080250-110080272 TTTTATATGGGCACGGTTTGTGG + Intergenic
1030567714 7:111180446-111180468 TCTTACATGGGTGAGGTTTGTGG + Intronic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1031170438 7:118286248-118286270 TCTGACCTGGGGAAGGTTTAAGG - Intergenic
1031564555 7:123279141-123279163 TCTTATATGGGTGGGGTTTGTGG + Intergenic
1031654876 7:124342347-124342369 TCTTATATGGGCATGGTTCCTGG + Intergenic
1032927773 7:136628699-136628721 TCTTGCATGGGCACAGTTTGTGG - Intergenic
1033107574 7:138542430-138542452 TCTTACATGGGTGTGGTTTGTGG + Intronic
1033139804 7:138816084-138816106 TCTTATATGGGTGAGGTTGGTGG - Intronic
1034188495 7:149196515-149196537 TCTTCCCTGGGCAAGCTTTCAGG - Intronic
1035167124 7:156998165-156998187 TCTTATATGGGCAAGGTTTGTGG + Intronic
1035796117 8:2358481-2358503 TCCTAGATGGTCAGGGTTTGGGG + Intergenic
1037191741 8:16134446-16134468 TCTTTTACGGGCATGGTTTGTGG - Intronic
1037223189 8:16551441-16551463 CCTCACATGGCTAAGGTTTGGGG + Intronic
1038045705 8:23764127-23764149 TACAACATGGGCAAGGTTAGGGG + Intergenic
1038526891 8:28282462-28282484 TCTTCCATGGGCACGGTTTGTGG - Intergenic
1038827915 8:31026132-31026154 TCTTATAAGGGCAAGGTCTTTGG + Intronic
1040386038 8:46915809-46915831 TCTTAAATGGGGAAGACTTGGGG + Intergenic
1040636268 8:49277161-49277183 TCTTACATGGGTGCAGTTTGTGG - Intergenic
1040774128 8:51018470-51018492 TCTTATATGGGCGTGGTGTGTGG + Intergenic
1041372570 8:57178169-57178191 TCTCAGGTGGGCACGGTTTGCGG + Intergenic
1041954016 8:63537283-63537305 GCTTAAATGGGCAAAGTATGGGG + Intergenic
1042363127 8:67905128-67905150 TATTATAAGGACAAGGTTTGGGG - Intergenic
1042409843 8:68451653-68451675 TCTTACATGGGTGTGGTTTGTGG + Intronic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1042882423 8:73508438-73508460 TCTTATATGGGCATGATTTGTGG + Intronic
1043098999 8:76016115-76016137 TCTTATATGGGAATAGTTTGTGG - Intergenic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1043990891 8:86752662-86752684 TCTTATATGGGCATAGTTTGTGG + Intergenic
1044030897 8:87235590-87235612 TCTTATATGTGCATAGTTTGCGG + Intronic
1044114304 8:88315564-88315586 TCTTAAATGGGCAGAGTTTGTGG - Intronic
1044289506 8:90451265-90451287 TCTTACGTGAGCATGGTTTTTGG + Intergenic
1044461189 8:92446356-92446378 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1044807729 8:96025396-96025418 TCTTATATGGGTAGGGTTTGTGG - Intergenic
1045399813 8:101802222-101802244 TATTTTATGGGCATGGTTTGTGG - Intronic
1046677738 8:117130244-117130266 TCTTTCATGGGAAAGCTCTGAGG + Intronic
1046957815 8:120079691-120079713 TTTTACATGGCCAACGTATGCGG + Intronic
1047106512 8:121736791-121736813 TCTTCTATGGGCATAGTTTGTGG + Intergenic
1048824349 8:138409326-138409348 TCTTACATGGGCATGCTTCATGG + Intronic
1050565105 9:6874025-6874047 TCTTATGTGGGCATGGTTTGTGG + Intronic
1051064378 9:13084749-13084771 TCTCATATGGGCACAGTTTGTGG - Intergenic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051123744 9:13780308-13780330 TCTTATATGGGCAACGTTCATGG - Intergenic
1051305466 9:15703866-15703888 TCTTCTATGGGCATGGTTTGTGG + Intronic
1051391511 9:16569674-16569696 TCTTACATGGCCCACTTTTGGGG + Intronic
1051721608 9:20042886-20042908 TCTTACATGGGCATGGCTTGTGG - Intergenic
1051753568 9:20370318-20370340 TCTTACATGGGTGCGGTTTGTGG - Intronic
1051767777 9:20543392-20543414 TCTTACATGGGTATGGCTTATGG + Intronic
1052111336 9:24586809-24586831 TCTTACATGGGCACGGTTACTGG + Intergenic
1053208709 9:36209589-36209611 TCTTATCTGGGAACGGTTTGAGG + Intronic
1053296470 9:36917950-36917972 TCTTATATGGGCACAGTTTGTGG - Intronic
1055873983 9:80920614-80920636 TCTTACATGGGTATGGTTTGCGG + Intergenic
1055906513 9:81300780-81300802 TCTTATATGGGCAGGGTTCACGG - Intergenic
1056227201 9:84507315-84507337 TCTTATATGTGCATGGCTTGTGG - Intergenic
1056274276 9:84977952-84977974 TCTTACATGGATATAGTTTGTGG - Intronic
1057727166 9:97575836-97575858 TCTGACATGGTAAAGGTGTGAGG + Intronic
1057823714 9:98355157-98355179 TCTTATCTGGGCATGGTTTGTGG + Intronic
1058638812 9:107063307-107063329 TCTTACATGGGCACAACTTGTGG + Intergenic
1058641723 9:107093593-107093615 TCTTACATGGGTGTGGTTTATGG + Intergenic
1058873477 9:109222379-109222401 TCTAACATGGAGAAGTTTTGTGG + Intronic
1058938969 9:109795651-109795673 TCTTCCATGGGCAAGAGATGAGG + Intronic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1059264747 9:113016623-113016645 TCTTATATGTGCATGGTCTGTGG - Intergenic
1059793528 9:117666256-117666278 TTTTACATATTCAAGGTTTGTGG + Intergenic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1186953321 X:14652645-14652667 TCTTATATGGGCATGGTTCCTGG - Intronic
1186969877 X:14830173-14830195 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1187474470 X:19598766-19598788 TCTTATATGGGCACAGTTTATGG + Intronic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1187890345 X:23928697-23928719 TCTTATATGGGCTCAGTTTGTGG - Intronic
1188221912 X:27551028-27551050 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1188291452 X:28393695-28393717 TCTTGTATGTGCATGGTTTGTGG + Intergenic
1188329900 X:28856676-28856698 TCCTATGTGGGCATGGTTTGTGG - Intronic
1188469131 X:30517619-30517641 TCTTATATGGTCATAGTTTGTGG - Intergenic
1188591391 X:31840769-31840791 TCCTATATGGGCACTGTTTGTGG - Intronic
1189060166 X:37745207-37745229 TCTTATATGGGTGTGGTTTGTGG + Intronic
1189174556 X:38942578-38942600 TCTTATATGGGCACGGTTCTTGG - Intergenic
1189869037 X:45362898-45362920 TCTTATTTTGGCAAGGTTTATGG - Intergenic
1189930869 X:46008395-46008417 TCTTATATGGGCATTGTTTGTGG + Intergenic
1190460827 X:50672133-50672155 TCTTATATGGGCACAGTTTGTGG + Intronic
1191761466 X:64652251-64652273 GCTTACCTGGGCAAGGTTTCAGG + Intergenic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1191957784 X:66664951-66664973 TGTCATATGGGCATGGTTTGTGG + Intergenic
1192028745 X:67485981-67486003 TCTTACATTGGCATGAGTTGTGG + Intergenic
1192328684 X:70156076-70156098 TCTTCTGTGGGCATGGTTTGTGG + Intronic
1192606556 X:72524959-72524981 TTTTCCATGGGCATGGTTGGGGG + Intronic
1193286533 X:79721494-79721516 TTATACATTGGCATGGTTTGGGG - Intergenic
1193396137 X:80985755-80985777 ACTTACATGGACACGGTTCGTGG + Intergenic
1193569038 X:83118807-83118829 TCTTGTATGGGCATGGTTCGTGG + Intergenic
1193833359 X:86314009-86314031 TTTTACATGGGCATGGTTTGTGG - Intronic
1193968563 X:88020901-88020923 TCTCACATGGGAAAGGATTCAGG + Intergenic
1194100510 X:89697422-89697444 TTTTACATGGGTATGGTTTGTGG + Intergenic
1194286475 X:92017116-92017138 TTTTATATGAGCAAGGTTTGTGG + Intronic
1194370769 X:93069082-93069104 ACTCACAGTGGCAAGGTTTGTGG - Intergenic
1194940208 X:100000104-100000126 TCTTAAAAAGGCATGGTTTGTGG - Intergenic
1195043747 X:101037542-101037564 TGTTACATGGGCAAATTGTGTGG + Intronic
1195162235 X:102182019-102182041 TCTTCCTTGGGCAAGGGTTAGGG + Intergenic
1195258941 X:103114524-103114546 CCTTACATGATCTAGGTTTGAGG - Intergenic
1195593332 X:106657761-106657783 TCTCACATGGGTGTGGTTTGTGG + Intronic
1195628394 X:107028474-107028496 TCTTATATGGGCATAGTTTGTGG + Intergenic
1195818955 X:108921688-108921710 TCTTATATGGGTATGGTTTGTGG - Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196564041 X:117183726-117183748 TCTTACATAGGCATGGTTGGTGG - Intergenic
1197473708 X:126894291-126894313 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1197561591 X:128029226-128029248 TCTTTTATGGGCATGGTTTGTGG + Intergenic
1198970688 X:142275704-142275726 TCTTTTATGGGCACAGTTTGTGG + Intergenic
1199090659 X:143688139-143688161 TCTTATATGGCCATGGTTTGTGG + Intergenic
1199103011 X:143827911-143827933 TTTTATATGGGCATAGTTTGTGG - Intergenic
1199359239 X:146898342-146898364 TCTTACATAGGCGTGGTTTGTGG - Intergenic
1200453462 Y:3358483-3358505 TTTTACATGGGTATGGTTTGTGG + Intergenic
1200604019 Y:5241667-5241689 TTTTATATGAGCAAGGTTTGTGG + Intronic
1200635054 Y:5641589-5641611 TCTTATCTGGGCCTGGTTTGTGG + Intronic
1200678564 Y:6180974-6180996 ACTCACAGTGGCAAGGTTTGTGG - Intergenic
1201512198 Y:14777561-14777583 TCTTAAATTTTCAAGGTTTGGGG + Intronic