ID: 1087673159

View in Genome Browser
Species Human (GRCh38)
Location 11:101129112-101129134
Sequence GAGGGAAAAGGGAAGGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7029
Summary {0: 2, 1: 6, 2: 131, 3: 1064, 4: 5826}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087673152_1087673159 -10 Left 1087673152 11:101129099-101129121 CCGTCTCCAGGAGGAGGGAAAAG 0: 1
1: 0
2: 4
3: 36
4: 374
Right 1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG 0: 2
1: 6
2: 131
3: 1064
4: 5826
1087673149_1087673159 -7 Left 1087673149 11:101129096-101129118 CCCCCGTCTCCAGGAGGAGGGAA 0: 1
1: 0
2: 0
3: 23
4: 258
Right 1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG 0: 2
1: 6
2: 131
3: 1064
4: 5826
1087673150_1087673159 -8 Left 1087673150 11:101129097-101129119 CCCCGTCTCCAGGAGGAGGGAAA 0: 1
1: 0
2: 0
3: 19
4: 255
Right 1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG 0: 2
1: 6
2: 131
3: 1064
4: 5826
1087673141_1087673159 6 Left 1087673141 11:101129083-101129105 CCCCTTTTCTCCTCCCCCGTCTC 0: 1
1: 1
2: 8
3: 116
4: 1198
Right 1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG 0: 2
1: 6
2: 131
3: 1064
4: 5826
1087673146_1087673159 -4 Left 1087673146 11:101129093-101129115 CCTCCCCCGTCTCCAGGAGGAGG 0: 1
1: 0
2: 1
3: 29
4: 390
Right 1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG 0: 2
1: 6
2: 131
3: 1064
4: 5826
1087673142_1087673159 5 Left 1087673142 11:101129084-101129106 CCCTTTTCTCCTCCCCCGTCTCC 0: 1
1: 1
2: 14
3: 231
4: 2107
Right 1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG 0: 2
1: 6
2: 131
3: 1064
4: 5826
1087673143_1087673159 4 Left 1087673143 11:101129085-101129107 CCTTTTCTCCTCCCCCGTCTCCA 0: 1
1: 1
2: 7
3: 127
4: 1178
Right 1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG 0: 2
1: 6
2: 131
3: 1064
4: 5826
1087673151_1087673159 -9 Left 1087673151 11:101129098-101129120 CCCGTCTCCAGGAGGAGGGAAAA 0: 1
1: 0
2: 3
3: 33
4: 376
Right 1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG 0: 2
1: 6
2: 131
3: 1064
4: 5826

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087673159 Original CRISPR GAGGGAAAAGGGAAGGAGGA GGG Exonic
Too many off-targets to display for this crispr