ID: 1087683304

View in Genome Browser
Species Human (GRCh38)
Location 11:101238123-101238145
Sequence TTGACTCAGATCATGAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087683304_1087683314 23 Left 1087683304 11:101238123-101238145 CCAGTTCTCATGATCTGAGTCAA No data
Right 1087683314 11:101238169-101238191 AGGATGGCTTGCTGATCAGTAGG No data
1087683304_1087683308 -10 Left 1087683304 11:101238123-101238145 CCAGTTCTCATGATCTGAGTCAA No data
Right 1087683308 11:101238136-101238158 TCTGAGTCAAGGTCCCAGTGGGG 0: 68
1: 74
2: 71
3: 57
4: 255
1087683304_1087683315 24 Left 1087683304 11:101238123-101238145 CCAGTTCTCATGATCTGAGTCAA No data
Right 1087683315 11:101238170-101238192 GGATGGCTTGCTGATCAGTAGGG No data
1087683304_1087683310 3 Left 1087683304 11:101238123-101238145 CCAGTTCTCATGATCTGAGTCAA No data
Right 1087683310 11:101238149-101238171 CCCAGTGGGGATCCATACTGAGG 0: 130
1: 75
2: 30
3: 33
4: 108
1087683304_1087683312 7 Left 1087683304 11:101238123-101238145 CCAGTTCTCATGATCTGAGTCAA No data
Right 1087683312 11:101238153-101238175 GTGGGGATCCATACTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087683304 Original CRISPR TTGACTCAGATCATGAGAAC TGG (reversed) Intergenic
No off target data available for this crispr