ID: 1087683312

View in Genome Browser
Species Human (GRCh38)
Location 11:101238153-101238175
Sequence GTGGGGATCCATACTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087683304_1087683312 7 Left 1087683304 11:101238123-101238145 CCAGTTCTCATGATCTGAGTCAA No data
Right 1087683312 11:101238153-101238175 GTGGGGATCCATACTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087683312 Original CRISPR GTGGGGATCCATACTGAGGA TGG Intergenic
No off target data available for this crispr