ID: 1087685861

View in Genome Browser
Species Human (GRCh38)
Location 11:101264470-101264492
Sequence GCAGTGTTATATATGACATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087685861_1087685866 4 Left 1087685861 11:101264470-101264492 CCATATGTCATATATAACACTGC No data
Right 1087685866 11:101264497-101264519 CCTTTCTTCTCTGGGAAGCTAGG No data
1087685861_1087685867 21 Left 1087685861 11:101264470-101264492 CCATATGTCATATATAACACTGC No data
Right 1087685867 11:101264514-101264536 GCTAGGTTGTTAGTTGTTCCCGG No data
1087685861_1087685863 -4 Left 1087685861 11:101264470-101264492 CCATATGTCATATATAACACTGC No data
Right 1087685863 11:101264489-101264511 CTGCCACTCCTTTCTTCTCTGGG No data
1087685861_1087685862 -5 Left 1087685861 11:101264470-101264492 CCATATGTCATATATAACACTGC No data
Right 1087685862 11:101264488-101264510 ACTGCCACTCCTTTCTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087685861 Original CRISPR GCAGTGTTATATATGACATA TGG (reversed) Intergenic
No off target data available for this crispr