ID: 1087685865

View in Genome Browser
Species Human (GRCh38)
Location 11:101264497-101264519
Sequence CCTAGCTTCCCAGAGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087685865_1087685869 11 Left 1087685865 11:101264497-101264519 CCTTTCTTCTCTGGGAAGCTAGG No data
Right 1087685869 11:101264531-101264553 TCCCGGTCAGACTCAGGAGATGG No data
1087685865_1087685872 15 Left 1087685865 11:101264497-101264519 CCTTTCTTCTCTGGGAAGCTAGG No data
Right 1087685872 11:101264535-101264557 GGTCAGACTCAGGAGATGGCAGG No data
1087685865_1087685868 5 Left 1087685865 11:101264497-101264519 CCTTTCTTCTCTGGGAAGCTAGG No data
Right 1087685868 11:101264525-101264547 AGTTGTTCCCGGTCAGACTCAGG No data
1087685865_1087685867 -6 Left 1087685865 11:101264497-101264519 CCTTTCTTCTCTGGGAAGCTAGG No data
Right 1087685867 11:101264514-101264536 GCTAGGTTGTTAGTTGTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087685865 Original CRISPR CCTAGCTTCCCAGAGAAGAA AGG (reversed) Intergenic
No off target data available for this crispr