ID: 1087685867

View in Genome Browser
Species Human (GRCh38)
Location 11:101264514-101264536
Sequence GCTAGGTTGTTAGTTGTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087685865_1087685867 -6 Left 1087685865 11:101264497-101264519 CCTTTCTTCTCTGGGAAGCTAGG No data
Right 1087685867 11:101264514-101264536 GCTAGGTTGTTAGTTGTTCCCGG No data
1087685864_1087685867 -1 Left 1087685864 11:101264492-101264514 CCACTCCTTTCTTCTCTGGGAAG No data
Right 1087685867 11:101264514-101264536 GCTAGGTTGTTAGTTGTTCCCGG No data
1087685861_1087685867 21 Left 1087685861 11:101264470-101264492 CCATATGTCATATATAACACTGC No data
Right 1087685867 11:101264514-101264536 GCTAGGTTGTTAGTTGTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087685867 Original CRISPR GCTAGGTTGTTAGTTGTTCC CGG Intergenic
No off target data available for this crispr