ID: 1087686418

View in Genome Browser
Species Human (GRCh38)
Location 11:101270836-101270858
Sequence GTGCACACATAGAAGTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087686418_1087686422 23 Left 1087686418 11:101270836-101270858 CCTTTAGACTTCTATGTGTGCAC No data
Right 1087686422 11:101270882-101270904 GTTGATGACCAGAGCCACCTTGG No data
1087686418_1087686419 -7 Left 1087686418 11:101270836-101270858 CCTTTAGACTTCTATGTGTGCAC No data
Right 1087686419 11:101270852-101270874 TGTGCACCTCCATGCTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087686418 Original CRISPR GTGCACACATAGAAGTCTAA AGG (reversed) Intergenic
No off target data available for this crispr