ID: 1087705288

View in Genome Browser
Species Human (GRCh38)
Location 11:101483552-101483574
Sequence TGCCAGGTATAGAACCTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087705288 Original CRISPR TGCCAGGTATAGAACCTTGG TGG Intronic
901889532 1:12250739-12250761 AGCCAGGTCTTGAACCTGGGTGG + Intronic
906855420 1:49298829-49298851 TAGAAGGTTTAGAACCTTGGAGG - Intronic
908321525 1:62983394-62983416 TGTCAGGTAGAGAGCCTTGTGGG + Intergenic
909946143 1:81665557-81665579 TCCCAGATATAGAGCCATGGAGG - Intronic
916964485 1:169921863-169921885 TGCTAGGAAGAGAATCTTGGTGG - Intronic
920578682 1:207084067-207084089 TCCCAGGCAGAGAACCTAGGAGG - Intronic
1064340150 10:14478255-14478277 TGCCAGTTATTGACCCTTGGTGG + Intergenic
1072227048 10:93379985-93380007 TGCCTGGTATAAAACATTGGGGG + Exonic
1074299660 10:112222452-112222474 TGCCAGGTATAGCAAATAGGTGG - Intergenic
1075116612 10:119632158-119632180 CGCCAGGTATAGAGCCCTTGAGG + Intergenic
1080337014 11:31209285-31209307 TGCCAGGTATGTTACCTCGGAGG - Intronic
1081187108 11:40057360-40057382 TCCCAGGTATGGAAACTTGGTGG - Intergenic
1084925771 11:72510354-72510376 TGCCAGCTAAAGAACTTTGTTGG + Intergenic
1087157852 11:94922267-94922289 ACACAGGTATAGAATCTTGGGGG - Intergenic
1087287950 11:96286369-96286391 TGCCAGGTTTAATACCTAGGTGG + Intronic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1094034061 12:26048045-26048067 GGCCAGGAATAAAAACTTGGAGG - Intronic
1098989164 12:77045931-77045953 TGCCAGGTTGACAACCCTGGAGG - Intronic
1100867958 12:98877518-98877540 TGCCATGTATACATCCTTGAAGG - Intronic
1101996350 12:109527940-109527962 TGCCAGGTGTTGCAGCTTGGGGG + Intronic
1118075497 14:62293861-62293883 GGCCAGGTAGAGAATCTTGTTGG + Intergenic
1118497052 14:66317038-66317060 TTCCAGGTATAGATGCTTGATGG - Intergenic
1120759662 14:88274133-88274155 GGCCAGGGAAAGAACCATGGCGG - Intronic
1128524487 15:68403110-68403132 TGGCAGGTCATGAACCTTGGAGG + Intronic
1130298076 15:82661135-82661157 GGCCAAGGACAGAACCTTGGGGG - Intronic
1132150601 15:99455459-99455481 TGCCAGGTATGAAACCGTTGGGG + Intergenic
1137613977 16:49836190-49836212 TGCCAGGCCTTGAACCTTGCTGG + Intronic
1137778212 16:51074160-51074182 GGCCAGATTCAGAACCTTGGAGG - Intergenic
1138356569 16:56385828-56385850 TGCCGGGTATATGACCTTGTTGG - Intronic
1139144813 16:64310394-64310416 TTCAAGGTATAGAGCTTTGGAGG + Intergenic
1140132190 16:72173064-72173086 AACCAGGTTTAGAAGCTTGGTGG - Intronic
1141112352 16:81280634-81280656 TACCAGGTATGTGACCTTGGAGG + Intronic
1145741837 17:27281298-27281320 AGCCAGGTATAGAGCCCTGTTGG - Intergenic
1148741591 17:49896407-49896429 AGCCAGGTCTACAACCTTGCTGG + Intergenic
1151265014 17:72948054-72948076 TTCCAGGTATAGGACTTTAGTGG + Intronic
1151280944 17:73073585-73073607 TGCAAAGAATAGAACCTTGGAGG + Intronic
1155077376 18:22371641-22371663 TGCCAGGCATAGAATCATGATGG - Intergenic
1156600541 18:38600492-38600514 TGCCAAGTAGAGAATATTGGTGG - Intergenic
1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG + Intronic
1159358572 18:67370035-67370057 TGTCAGATATAGAACTTCGGTGG + Intergenic
1159541885 18:69788250-69788272 TGCCAGTTCTAGTACCTTGTTGG - Intronic
1167092631 19:47355079-47355101 TGTCAGGAATACAATCTTGGTGG - Exonic
929811305 2:45191192-45191214 TGCCAGGGATTGAAACATGGAGG + Intergenic
931258392 2:60595326-60595348 TGCTAGGGATAGATCCTAGGAGG - Intergenic
936654887 2:114473644-114473666 TCCCAGATATTGAACCTTAGAGG + Intronic
937669823 2:124526548-124526570 AGACAGGTATAGAGCCTTGCAGG - Intronic
939108301 2:137975715-137975737 TGTCAGGTTTAGAAACTAGGAGG + Intronic
940138387 2:150464960-150464982 TGCAAGGCATAGAATATTGGAGG - Intergenic
1170369087 20:15628720-15628742 TCCCAGGTCTGGCACCTTGGTGG + Intronic
1172222729 20:33284832-33284854 TGCCAGGGAGAGGAGCTTGGGGG - Intronic
1176193746 20:63826974-63826996 TGCCAGGTCTGGAACCGTGCGGG + Intronic
1178258034 21:31073211-31073233 TGCCATGTACAGAACCCTGCAGG - Intergenic
1182075056 22:27489965-27489987 TCCCATCTATACAACCTTGGGGG - Intergenic
1182110205 22:27717849-27717871 TGCCAGGTAAAGGAAGTTGGAGG + Intergenic
1183679455 22:39319190-39319212 TGGGAGGTAAAGAAGCTTGGGGG - Intronic
1183979150 22:41529599-41529621 TGCCACGATTAGAACCTAGGTGG - Intronic
1184853591 22:47134844-47134866 TGCCAGGCAGAGGACCCTGGAGG - Intronic
1184940013 22:47757219-47757241 TGTCAGGTAAAGAATGTTGGTGG - Intergenic
1184982903 22:48106905-48106927 TGGCAGGTATTGGACCATGGGGG - Intergenic
949916207 3:8966593-8966615 TGACAGGGACTGAACCTTGGTGG + Intergenic
958833833 3:99120528-99120550 GGCCAGGGACAGAACCTTGAGGG + Intergenic
960042078 3:113160867-113160889 TGCAAGGTAAAAATCCTTGGTGG - Intergenic
963097330 3:141557849-141557871 TTCCAGATTTGGAACCTTGGGGG - Intronic
965893708 3:173546801-173546823 TCCAAGATATAGAACATTGGTGG - Intronic
966807080 3:183816138-183816160 TGCCAGGGCTAGCACCTGGGAGG + Exonic
968499956 4:945179-945201 TGCCTGGAATGGACCCTTGGAGG + Intronic
968651684 4:1762658-1762680 TGCCAGGTTTAGACCCCTGCAGG - Intergenic
969157653 4:5225596-5225618 TGACAGGTTCAGAACCTTAGAGG + Intronic
974258025 4:59487525-59487547 TGCCAGGTTTTATACCTTGGGGG + Intergenic
974493247 4:62594175-62594197 TTTCAGGTAGAGAACATTGGTGG + Intergenic
976380322 4:84391383-84391405 TGCCAGGTAGCGAAGCATGGGGG - Intergenic
980274921 4:130637908-130637930 TGCCAGGAAGAGAAATTTGGAGG + Intergenic
985690783 5:1311068-1311090 GCCCAGGTACAGAATCTTGGGGG + Intergenic
993784340 5:92109981-92110003 TGGCTGGTATAGAAGGTTGGTGG + Intergenic
1006105602 6:31714399-31714421 TGCCAGCTTTACTACCTTGGAGG + Intronic
1006883267 6:37357866-37357888 TGCCAGGTATAGAAACACAGTGG + Intronic
1008136979 6:47788280-47788302 TACCAGGTAGAGCACCTTAGGGG - Intronic
1008228264 6:48950640-48950662 TGCAAGGTATTGATCCTGGGTGG + Intergenic
1009796641 6:68477786-68477808 TGCCAGGGATAGAACCTGGATGG - Intergenic
1014555070 6:122836069-122836091 TGCCAAGGATACAACCTTGAAGG + Intergenic
1018542536 6:164898050-164898072 TGCCAGGAATAGGCCCTTTGGGG - Intergenic
1024518745 7:50284334-50284356 TGGCAGCTCTAGAACCTTGGAGG + Intergenic
1035012732 7:155733962-155733984 TGCCAAGTCTGGAACCTGGGAGG - Intronic
1038089027 8:24233296-24233318 TGCCAGGAAAATAAGCTTGGAGG + Intergenic
1038602910 8:28965668-28965690 TGCAAGGTATAAAAGCTTTGAGG + Intronic
1041036903 8:53801385-53801407 TTGCAGGTATAGAAACTTTGAGG - Intronic
1043270165 8:78323119-78323141 AGCCAGTTACAGAACTTTGGAGG - Intergenic
1051305162 9:15700524-15700546 TGCCTGGGCTCGAACCTTGGCGG - Intronic
1053225844 9:36356211-36356233 GGCCAGGTATATAACCTTAGTGG - Intronic
1053496648 9:38553055-38553077 TGCAGGGTTTAGTACCTTGGCGG - Intronic
1056727889 9:89138090-89138112 TGCCAGCTACAGAGACTTGGGGG + Intronic
1060052508 9:120387294-120387316 TCCCAGGTAGAGGTCCTTGGGGG + Intergenic
1061280150 9:129593362-129593384 GCCCAGGTATGAAACCTTGGAGG + Intergenic
1194776478 X:97971522-97971544 TGCCAGGTATAGAATATTTTTGG + Intergenic
1195738004 X:108033386-108033408 TGCCAGGAATAGAACTCAGGTGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic