ID: 1087705909

View in Genome Browser
Species Human (GRCh38)
Location 11:101491692-101491714
Sequence CAGTGCAAAGACTTTGTTGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087705909_1087705910 6 Left 1087705909 11:101491692-101491714 CCAACAACAAAGTCTTTGCACTG 0: 1
1: 0
2: 1
3: 16
4: 218
Right 1087705910 11:101491721-101491743 CAGTTTTTTGTAGTCATTCTAGG 0: 1
1: 0
2: 0
3: 19
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087705909 Original CRISPR CAGTGCAAAGACTTTGTTGT TGG (reversed) Exonic
900990543 1:6096386-6096408 AAGTGCAAAGACTGTGGTGCTGG - Intronic
902706182 1:18206591-18206613 AAGTGCAAAGACCTTGGTGTGGG + Intronic
903353022 1:22729585-22729607 CAGTGCAAAGGCCCTGTGGTGGG - Intronic
904668066 1:32139375-32139397 AAGTGCAAAGGCTATGTAGTAGG + Intronic
906089388 1:43165644-43165666 CAGTGGAGAGACTAGGTTGTAGG - Intronic
907708992 1:56860256-56860278 CTGTGCTAAGACTCTGTGGTTGG + Intronic
908205132 1:61839442-61839464 TAGTGCAAGTAATTTGTTGTGGG + Intronic
909814688 1:79977099-79977121 AAGTGCCAAGACTTTGGGGTGGG + Intergenic
913967326 1:143387889-143387911 CAGCCCGAAGACTTTGTGGTGGG - Intergenic
914061705 1:144213496-144213518 CAGCCCAAAGACTTTGTGGTGGG - Intergenic
914117445 1:144752873-144752895 CAGCCCAAAGACTTTGTGGTGGG + Intergenic
915457290 1:156049328-156049350 CAGAGCAAAGACTTGGGGGTGGG - Intronic
915911622 1:159919007-159919029 CAGAGCACAGGCTTTGCTGTTGG + Intronic
917459733 1:175219550-175219572 CAGTGCAAAGACCCTGAAGTGGG - Intergenic
917702470 1:177595182-177595204 GAATGCAAAGACTTCCTTGTTGG - Intergenic
918162910 1:181918004-181918026 GAGTGCAAAGAGTTTGTGGCTGG - Intergenic
918991957 1:191708312-191708334 CAGTGCTAAGTATTTTTTGTTGG + Intergenic
920235436 1:204500310-204500332 CTTTGCAGAGAATTTGTTGTAGG - Intergenic
920543519 1:206797106-206797128 CAGTGTAGAGACTTTGCTGCGGG + Intergenic
924298040 1:242608581-242608603 CAATGAAAAGACTTCTTTGTGGG + Intergenic
924414651 1:243847023-243847045 CAGGACAAAGTATTTGTTGTCGG + Intronic
924661964 1:246028352-246028374 CAGTTCAAAGAGTTTTTTGGTGG - Intronic
1063677291 10:8152310-8152332 CATTGCAAAGAATATGATGTGGG + Intergenic
1068200226 10:53774681-53774703 CAGTGCAAAAACAATGTTATTGG + Intergenic
1069065484 10:63937842-63937864 CAGTGCAGTGACTTTACTGTGGG + Intergenic
1070193635 10:74135574-74135596 CATTGTAAATACTTTTTTGTCGG + Intronic
1072266546 10:93733685-93733707 CAATGCAAAGACATAGATGTAGG + Intergenic
1072825378 10:98600532-98600554 ATGTGCAGAGACTTTGTTTTTGG - Intronic
1074924480 10:118053360-118053382 CAGTGCAAAGACTGTCATCTAGG - Intergenic
1075563209 10:123483321-123483343 CAGTGCAGACACCCTGTTGTGGG - Intergenic
1078186401 11:9055334-9055356 CAGCTCAAAGACCTAGTTGTGGG + Intronic
1078263409 11:9733390-9733412 CTGTGCAAAAACTTTGCTCTGGG + Intronic
1080936313 11:36867731-36867753 CTGTGCCAAGACATTGTTTTTGG - Intergenic
1081001982 11:37685664-37685686 CTGTGCAAAGATTTTATTTTGGG + Intergenic
1081187357 11:40060468-40060490 CAGTGCATAAACATTGTTGATGG - Intergenic
1083922543 11:65788363-65788385 CAGACCAAAGACTTTGTTGGGGG - Intronic
1085001689 11:73042934-73042956 CAGTTCAAAGAGTTTTTTGTTGG + Intronic
1085812566 11:79697996-79698018 CAGTGCAAAGATTTTGTGGCTGG + Intergenic
1086068341 11:82770414-82770436 CAATACAAAGATTTTTTTGTGGG - Intergenic
1087215045 11:95484445-95484467 CAGTGCCAGGACTGTATTGTTGG - Intergenic
1087275229 11:96154581-96154603 TACTGAAAATACTTTGTTGTTGG - Intronic
1087705909 11:101491692-101491714 CAGTGCAAAGACTTTGTTGTTGG - Exonic
1089297316 11:117477933-117477955 GAGTGCAAAGCCCTTGTGGTAGG + Intronic
1089773090 11:120817154-120817176 CACAGCAAAGACTGTGTGGTGGG - Intronic
1092855919 12:12673659-12673681 GAGTGCAAAGACCCTGGTGTAGG + Intronic
1096661117 12:53124608-53124630 CAGAGGCAAGACTTTGTGGTAGG + Intergenic
1097626211 12:62003406-62003428 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
1098953040 12:76661481-76661503 CTTTGCAAAGACTTTGATGATGG + Intergenic
1099349494 12:81547063-81547085 CAGTGCCTAGATTTTGGTGTTGG + Intronic
1105658418 13:22465755-22465777 ATGTACAAAGCCTTTGTTGTAGG - Intergenic
1106614278 13:31312046-31312068 CAAGGAAAAGACTTTGATGTGGG + Intronic
1107266142 13:38557428-38557450 CAGTGCACAGTATTTTTTGTGGG - Intergenic
1108306856 13:49145615-49145637 CATTGCAAATAATTTGTTGTGGG - Intronic
1108871901 13:54998227-54998249 CAGTGACGAGACATTGTTGTTGG + Intergenic
1109735229 13:66475166-66475188 CAGAGGAAAGCATTTGTTGTTGG + Intronic
1110811114 13:79811397-79811419 CAGTGCAAAGTATCAGTTGTAGG + Intergenic
1111278873 13:85991276-85991298 AAATGCACAGACTTTCTTGTGGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112520577 13:100091185-100091207 CAGTGGGAAGACATTGATGTTGG + Intronic
1113207306 13:107931685-107931707 CATTGCACACACTTTGTTGTTGG + Intergenic
1113242182 13:108350239-108350261 AAATACAAAGACTTTGTTGAAGG + Intergenic
1114495152 14:23127040-23127062 CAGTGGTAGGACTTTGGTGTGGG - Exonic
1116700012 14:48229246-48229268 CATTGCAAAGCCTTTGATGTTGG - Intergenic
1116751210 14:48886816-48886838 TAATTCAGAGACTTTGTTGTAGG + Intergenic
1116889902 14:50258193-50258215 CAGTGGAGAGACATTGGTGTTGG - Intronic
1118582150 14:67312261-67312283 CAGTGCAAAGAAATTGTAGTTGG - Intronic
1118622629 14:67627833-67627855 CTAGGCAAAGACTTTTTTGTGGG - Intronic
1125383865 15:39115544-39115566 CTGTGCAAAGATCTTGGTGTTGG + Intergenic
1128912890 15:71532223-71532245 CAGTGCTAAGAGTTTAGTGTTGG - Intronic
1134041329 16:11070768-11070790 CAGAGCAAAGACTCTGAGGTGGG - Intronic
1134071041 16:11259965-11259987 CAGTGCAAAGGCCCTGTGGTGGG + Intronic
1136074417 16:27807065-27807087 CACTTCAAACACTTTGCTGTGGG - Intronic
1138060219 16:53882525-53882547 CACTGCAAAGGCTGTGTGGTGGG + Intronic
1143133620 17:4697110-4697132 CAGTGCAAGGCCTGGGTTGTAGG + Intronic
1146017557 17:29245963-29245985 CAGGGCAGTGACTTTGGTGTTGG + Intergenic
1150470530 17:65433446-65433468 CAATGCAAAGGCTTTGTGGTGGG + Intergenic
1153110044 18:1575310-1575332 CAGTCCAAAGAGTATGTTATTGG - Intergenic
1153995297 18:10434867-10434889 CACTGCAAAGAAATTGTAGTTGG - Intergenic
1155623348 18:27806861-27806883 CAGTGCAAAGAATCTGATGCCGG + Intergenic
1156342200 18:36219875-36219897 CAGTGCAAAGAAGATGATGTAGG - Intronic
1157078214 18:44491959-44491981 CATTGCTAATTCTTTGTTGTAGG + Intergenic
1158852511 18:61509448-61509470 CAGTGCAAAGGCTTTGAGGTGGG + Intronic
1159454688 18:68645504-68645526 CAGTGCACAGTCTGTGTTTTTGG - Intergenic
1160653634 19:247637-247659 CAGTGTAAAGAGCTTATTGTAGG + Intergenic
1161629367 19:5344554-5344576 CAGTGCAAAGGCTCTGTGGCAGG - Intergenic
1162892358 19:13743030-13743052 CACTGCAAAGACCTTAGTGTGGG - Intronic
1162910575 19:13845949-13845971 CAGTGCACAGGCTTTGCGGTAGG + Intergenic
1162950106 19:14066358-14066380 CAGTGCAAAGACCCTGAGGTGGG + Intergenic
1163157453 19:15447255-15447277 CAGTGCAAAGGCCCTGTGGTGGG - Intronic
1165065282 19:33225073-33225095 CAGTGCAGTGACTTTATTCTTGG - Intronic
1165208772 19:34215481-34215503 CATTGCACAGGCTTTGTTTTGGG + Intronic
1165298536 19:34949760-34949782 AAGTGCAATGCCTTTGTTGCAGG - Intergenic
1165608460 19:37128548-37128570 CAGTGTGAAGTCTTTGATGTTGG - Exonic
1166022492 19:40044941-40044963 CAGTGAGAAGAGTTTCTTGTAGG - Intronic
1166575935 19:43837829-43837851 AAATGCAAAGACCCTGTTGTTGG + Intronic
1166687469 19:44804193-44804215 CAGTGCAGAGACTATATGGTGGG - Intergenic
1167529936 19:50008910-50008932 CTGGGCAAAGACTGTGTTGAGGG + Intronic
1167923210 19:52801296-52801318 CATCCCAAAGAATTTGTTGTAGG - Exonic
1167928293 19:52841745-52841767 CATCCCAAAGAATTTGTTGTAGG - Exonic
1167993460 19:53381106-53381128 CAGCCCAAAGAATTTCTTGTAGG + Exonic
1167996543 19:53408082-53408104 CAGCCCAAAGAATTTCTTGTAGG + Exonic
1168002023 19:53455034-53455056 CAGCCCAAAGAATTTCTTGTAGG + Exonic
1202701112 1_KI270712v1_random:165383-165405 CAGCCCGAAGACTTTGTGGTGGG - Intergenic
925883978 2:8378389-8378411 CAGTGAAAATAATTTGTTTTGGG + Intergenic
926092353 2:10059061-10059083 CAGGGCAAAGACTTCGGTTTGGG - Intronic
929356580 2:41031733-41031755 CAGTTCAAATACTTTGTCATCGG + Intergenic
929775168 2:44926149-44926171 CAGTGGGAAGAGTTTGGTGTAGG + Intergenic
929870891 2:45758467-45758489 AAGTGCAAAGACTCTGAGGTAGG - Intronic
931723323 2:65083435-65083457 CACTACAAACATTTTGTTGTAGG - Intronic
932607886 2:73176595-73176617 CAGGGCAAAGTCTTGTTTGTAGG - Intergenic
932910060 2:75796995-75797017 AAGTGCAAAAACTTTGAAGTGGG + Intergenic
934086804 2:88516663-88516685 CAGTTCAAATATTTTTTTGTGGG + Intergenic
934172039 2:89548859-89548881 CAGCCCGAAGACTTTGTGGTGGG - Intergenic
934282347 2:91623176-91623198 CAGCCCGAAGACTTTGTGGTGGG - Intergenic
936718999 2:115226556-115226578 CAGTTCAAAGATTTTGTTCACGG - Intronic
937523058 2:122734926-122734948 CAGTGCAATGTCTTTGTGGCTGG + Intergenic
939368653 2:141268451-141268473 TAGTGCACAGTCTTTGTGGTTGG - Intronic
939892886 2:147758179-147758201 CAGTGCAAAGGCCTTGAGGTGGG - Intergenic
941702803 2:168622659-168622681 CAATGCAAAGTCTTTGAGGTTGG - Intronic
941866021 2:170335806-170335828 CACTGCAAAAACTCTGTTGGAGG - Intronic
942118997 2:172758197-172758219 CAGTGCAAAGGCTCAGGTGTGGG + Intronic
944121823 2:196248741-196248763 AAATGCTAAGACTTTGTGGTGGG + Intronic
945396584 2:209325488-209325510 CAATCCAGAGACTTTGTTTTTGG - Intergenic
948609498 2:239157820-239157842 CAGTGCAAAGAATGTGCTGAAGG + Intronic
1169539326 20:6582104-6582126 CAGTGCAAAGGCCCTGTGGTAGG + Intergenic
1169827640 20:9787334-9787356 CAGTGCAAAGACCTGGAGGTGGG - Intronic
1170162911 20:13333537-13333559 CAGTGTAAAGAGTTTGTGGCAGG - Intergenic
1172281838 20:33713290-33713312 CAGTGCAAAGACCTTGAGATAGG - Intronic
1172888683 20:38248397-38248419 CCCTGCCAAGACTTTGTTTTTGG + Intronic
1173693281 20:44983067-44983089 CAGTGCAAAGACCTTGAGGCTGG + Intronic
1176882392 21:14213391-14213413 CCAGGCACAGACTTTGTTGTTGG + Intergenic
1178139653 21:29668425-29668447 AAGTGCAAAGGCTATGATGTGGG + Intronic
1178818652 21:35954924-35954946 CAATGCAAAGATTCTGTGGTGGG - Intronic
1179236999 21:39556408-39556430 CACAGAAAAGGCTTTGTTGTAGG - Intergenic
1181274162 22:21677962-21677984 CAGTGCAAAGACCCTGAGGTGGG + Intronic
1182429250 22:30290381-30290403 CAGTGCTCAGACTTTGGTGGGGG + Intronic
1182609908 22:31538810-31538832 CAGTGCAAAGACTAGGTGTTGGG - Intronic
1182764369 22:32748035-32748057 CAGTGAAAAGAGCTTGGTGTTGG + Intronic
1184157833 22:42680267-42680289 CAGTGCATTCACATTGTTGTGGG + Intergenic
950951251 3:17002243-17002265 CAGTTCTAAGAGTTTGTTGATGG + Intronic
952105010 3:30059426-30059448 AAGTGCAAAGGCATTGATGTGGG - Intergenic
955454917 3:59109616-59109638 AAGTGCAAAGATTCTGTGGTGGG + Intergenic
957239302 3:77638080-77638102 CAGTGCAAAGACATTTATTTTGG + Intronic
957764803 3:84609675-84609697 CAGTGCAAAGACTATCTGGATGG - Intergenic
959502520 3:107123025-107123047 AAGTGCAATGAGTGTGTTGTTGG - Intergenic
959969906 3:112397783-112397805 TAATGCCAAGACTTTGTTGAAGG - Intergenic
962333140 3:134498437-134498459 CAGTTCTAAGACTTTTTTGGTGG + Intronic
962540331 3:136375343-136375365 CAATAGAAAGATTTTGTTGTGGG + Intronic
963828773 3:149984650-149984672 CACTGCAAAGACTGAGTGGTTGG + Intronic
965141720 3:164845913-164845935 TAGGGCAAAGACATTGTGGTTGG + Intergenic
965882327 3:173400659-173400681 CAGTATAAATACTGTGTTGTGGG - Intronic
966378978 3:179324276-179324298 TTGTGCATAGACTTTCTTGTTGG + Intronic
966599792 3:181763777-181763799 AAGTGCAAAGGCTCTGTGGTAGG + Intergenic
966636185 3:182136333-182136355 CAGTGCAAATACAGTGATGTGGG + Intergenic
966653612 3:182328026-182328048 CTGTAAAATGACTTTGTTGTTGG - Intergenic
966686392 3:182700229-182700251 CATTGCAGAGACTTGGTTGCAGG - Intergenic
968016385 3:195337974-195337996 CAGTGCAAAGGCATTGAGGTGGG - Intronic
969413547 4:7044341-7044363 CAGTGCACAGAGTCTTTTGTGGG + Intronic
971100279 4:23458948-23458970 AAGTGCAAAGTTTCTGTTGTGGG + Intergenic
971845633 4:31914882-31914904 CAGTGTAAAGACAGTGTAGTGGG - Intergenic
972027399 4:34400363-34400385 AATTGCAAAGACTTTTTTTTGGG + Intergenic
972633243 4:40859845-40859867 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
973819552 4:54651039-54651061 CTGTGCAGTGCCTTTGTTGTAGG + Intergenic
976036052 4:80822201-80822223 CAATGAAAATACTTTGTTGAAGG + Intronic
976214522 4:82703528-82703550 CAGAGCAAAGAATTTATTCTAGG + Intronic
978135536 4:105254090-105254112 TATTGTAAAGACTTTGGTGTTGG + Intronic
978482247 4:109206521-109206543 CAGTACCAAAAGTTTGTTGTGGG - Intronic
978644267 4:110910550-110910572 CAGATAAAATACTTTGTTGTTGG - Intergenic
979544557 4:121925160-121925182 CAATGCAAAGACTTTGTAGTGGG - Exonic
981768987 4:148284870-148284892 TAGTGAGAAGACTTTTTTGTAGG - Intronic
982444156 4:155470744-155470766 CAATGCAGAGACTCTGTTCTTGG + Intergenic
983800568 4:171924403-171924425 AAATGCAAAAACTTTGTGGTGGG + Intronic
984309398 4:178037733-178037755 CAGTCAAAAGTCTTTGATGTGGG - Intergenic
985221128 4:187706518-187706540 CAGTGCAAAAACTCTGTAGGAGG + Intergenic
986828968 5:11554024-11554046 CTGTTCAAAGAATTTGATGTAGG - Intronic
987117178 5:14735007-14735029 CTCTGCAAAGACCTTGTTGAGGG + Intronic
987858288 5:23450074-23450096 TAGGGCAAAGACTTTGAAGTTGG + Intergenic
990595174 5:57305692-57305714 CAGTGGACAGACTGTGCTGTTGG + Intergenic
994047322 5:95324844-95324866 CACTGCCAAGACTTTCATGTGGG + Intergenic
997747907 5:136315733-136315755 CAATGCAAGGATTTTGTAGTGGG - Exonic
998391792 5:141791809-141791831 CAGTGCAAAGGCTCTGAGGTGGG + Intergenic
999275765 5:150329062-150329084 CAGTGCAAAGGCCCTGTTGGGGG - Intronic
1000714478 5:164623552-164623574 AAGTGCAAAGACTTTGATTGAGG + Intergenic
1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG + Intergenic
1001779730 5:174357592-174357614 GGTTGCAAAGAGTTTGTTGTTGG + Intergenic
1003455527 6:6278433-6278455 CAGTGCAAAGACCCTGTGGGAGG + Intronic
1004378368 6:15111009-15111031 TATTGCCAAAACTTTGTTGTAGG + Intergenic
1004848311 6:19670094-19670116 CAGTGCACATACATTGGTGTAGG - Intergenic
1010550066 6:77210756-77210778 CAGTCCAAATACTTTTTTGGTGG + Intergenic
1011185684 6:84673188-84673210 CAGTACAAAAAGTTTGTAGTAGG - Intergenic
1012412205 6:98971364-98971386 CAGGGCAAAGACTCTACTGTGGG + Intergenic
1013418252 6:109943816-109943838 CAGTGCAATGACTGTGTTATGGG - Intergenic
1013568542 6:111395583-111395605 CAGTTCTAAGAGTTTTTTGTTGG + Intronic
1014723211 6:124943992-124944014 CACTGCAAAGACCTTTTTTTTGG - Intergenic
1014991968 6:128091417-128091439 CATAGCAAAGACTGTGTTTTCGG - Intronic
1015471412 6:133610925-133610947 TAGTGCAAAGACCTCCTTGTTGG + Intergenic
1016196101 6:141343173-141343195 CAGTTCTAAGAGTTTGTTGGTGG + Intergenic
1016297953 6:142596345-142596367 CAGTGCTAAGACCTTGTGCTGGG + Intergenic
1017974989 6:159349028-159349050 AAGAGAAAAGGCTTTGTTGTGGG - Intergenic
1019496454 7:1342652-1342674 CAGAGCATGGAATTTGTTGTAGG - Intergenic
1020682983 7:11259536-11259558 CAGTCTAATGCCTTTGTTGTGGG - Intergenic
1020700294 7:11473712-11473734 CAGGGCAAACACTTTGCTGGAGG - Intronic
1020909613 7:14112111-14112133 CAATGCAAAGGCTCTGATGTGGG - Intergenic
1026279487 7:68909488-68909510 CAGTACAAAGGCTATGTTGGAGG + Intergenic
1027542781 7:79489019-79489041 CAGTGAAAAGACATAGATGTGGG - Intergenic
1029024481 7:97401578-97401600 CAATGCAAAGATTTTATTCTGGG - Intergenic
1030385680 7:108865207-108865229 CAATGCAAAGACTTTGAGATAGG - Intergenic
1031556036 7:123177614-123177636 CAGTGCAAAGACCTTATTGCAGG - Intronic
1032527430 7:132589920-132589942 CAGTGCAAAGGCTGTGAGGTGGG + Intronic
1035264130 7:157680738-157680760 GAGTGTAAAGACTTTCTGGTTGG - Intronic
1035513163 8:207432-207454 CAGTGTAAAGAGCTTATTGTAGG + Intergenic
1035892609 8:3362033-3362055 CAACGCAAAGATTTTGTTCTTGG + Intronic
1039307972 8:36284479-36284501 CAGTTCAAATAGTTTTTTGTTGG + Intergenic
1044643393 8:94410540-94410562 CAATGCAAAGACACTGTAGTTGG + Intronic
1044818274 8:96135282-96135304 CAGTGCAGAGAATTTGTTTTGGG - Intergenic
1045282725 8:100763321-100763343 AAGTGCCAAGGCTTTGTGGTAGG - Intergenic
1045832414 8:106479367-106479389 CAGTGCATAGACTATGTTAATGG - Intronic
1047128036 8:121985165-121985187 TTGTGCAAAGGCTCTGTTGTAGG - Intergenic
1048506638 8:135027551-135027573 CGGTGCTAAGTCTTTTTTGTAGG - Intergenic
1050393888 9:5175486-5175508 CATTTTAAAGACTTTGTTTTGGG - Intronic
1051010635 9:12409260-12409282 CAATGCAAGGACTTGGTTGAAGG + Intergenic
1051056194 9:12989870-12989892 AAGTGCAAAGCCTTTGTAGTAGG + Intergenic
1055488589 9:76781426-76781448 CAGTGCAAAGGCTCTGAAGTGGG - Intronic
1059055742 9:110977449-110977471 CAAACCAAAGACTTTGTTTTAGG - Intronic
1187731371 X:22258579-22258601 GAGTCCAAAGACTTAGTGGTAGG + Intergenic
1188816203 X:34717565-34717587 AAGAACAAAGACTTTGTTGGTGG + Intergenic
1188966793 X:36563749-36563771 CACTGCACAAACTTTGTTCTAGG + Intergenic
1189327377 X:40121003-40121025 CAGTGCAAAGGCCCTGTGGTAGG + Intronic
1189431803 X:40953635-40953657 CTGTGCCAAGGCTTTGGTGTGGG + Intergenic
1189769154 X:44405458-44405480 CAGTTCAAACACTTTTTTGGTGG + Intergenic
1195350859 X:103995945-103995967 CAGTGCAGAAACTGGGTTGTTGG - Intergenic
1195601881 X:106758046-106758068 CAGTTCTAATAGTTTGTTGTGGG - Intronic
1197113780 X:122807074-122807096 CTGTGCAAAAGCTTTGTAGTTGG - Intergenic
1198657109 X:138926619-138926641 CAGTGCAAAGGCTCTAATGTAGG + Intronic
1198813553 X:140561660-140561682 CAATTCTAAGAGTTTGTTGTTGG + Intergenic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic