ID: 1087708339

View in Genome Browser
Species Human (GRCh38)
Location 11:101520940-101520962
Sequence GCAAAGGAATGATCTGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 755
Summary {0: 1, 1: 7, 2: 64, 3: 157, 4: 526}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087708337_1087708339 14 Left 1087708337 11:101520903-101520925 CCTGGCAGCTTCTAACAGCATTT 0: 1
1: 1
2: 33
3: 104
4: 477
Right 1087708339 11:101520940-101520962 GCAAAGGAATGATCTGAAACTGG 0: 1
1: 7
2: 64
3: 157
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087708339 Original CRISPR GCAAAGGAATGATCTGAAAC TGG Intronic
900738391 1:4314726-4314748 GCAAAGAGATGATCTGACACTGG - Intergenic
902085266 1:13855491-13855513 ACAAAGAGATTATCTGAAACTGG + Intergenic
902540660 1:17152182-17152204 GCAAATAAATGACCTGAAACTGG + Intergenic
903086211 1:20861878-20861900 GCAGAAGAATCATCTGAACCTGG + Intronic
904174898 1:28620225-28620247 GCAAAAGAATCACCTGAACCCGG - Intronic
904278959 1:29405042-29405064 TCAGAGAAATGACCTGAAACTGG + Intergenic
904624394 1:31793907-31793929 GCAGAGGCAGGAGCTGAAACAGG + Intronic
905834785 1:41108337-41108359 GCTAAGGTATAATCTGAAACTGG + Intronic
906083527 1:43109686-43109708 GCAAAGAGATGATCTAAAACTGG - Intergenic
906115669 1:43355333-43355355 GCACAAGAATGACTTGAAACCGG + Intergenic
907397047 1:54198424-54198446 GCAAGAGAATGATGTGAACCCGG - Intronic
907720817 1:56970582-56970604 GCAATGGAAAGAAATGAAACAGG + Intergenic
907920303 1:58905220-58905242 GTAAAGCCAAGATCTGAAACTGG - Intergenic
908620577 1:65975371-65975393 GCAAAGAGATTATCTGAAACTGG + Intronic
908663353 1:66462256-66462278 ACAAAGAAATGGTCTGAAATTGG + Intergenic
908743961 1:67357282-67357304 GCACAGGAATTACTTGAAACTGG + Intronic
908878974 1:68709701-68709723 GCAAAGAGATGGTCTGAAATTGG + Intergenic
909100548 1:71343046-71343068 CAAAAGAAATAATCTGAAACTGG - Intergenic
909133385 1:71767516-71767538 GCAAAGAAATGACCTGGAACTGG + Intronic
909503667 1:76363155-76363177 GCAAAGAAATTACCTAAAACTGG - Intronic
910128591 1:83874731-83874753 GCAAAGGTAGAATTTGAAACTGG - Intronic
910270343 1:85387297-85387319 GCAAAGGAATGAGCTTAAGTTGG - Intronic
911009427 1:93263367-93263389 ACAAAGAGATGATCTGAAATTGG - Intronic
911235065 1:95403753-95403775 GCAAAGAGATGGTCTGAAATTGG + Intergenic
911302481 1:96192384-96192406 GCAAAGAAATGACCTGAGACTGG + Intergenic
911708393 1:101041073-101041095 ACAAAGAAATGACCTGAAACTGG - Intergenic
912192218 1:107353238-107353260 GCAAAGAAATGGCTTGAAACTGG - Intronic
913384335 1:118242910-118242932 GCTTAGGAATGATATGAAGCAGG - Intergenic
914905041 1:151737148-151737170 GCAAAGAAATGATGTAAAACTGG + Intergenic
914920374 1:151842922-151842944 GCAAAAGTATGATGAGAAACAGG + Intergenic
915535577 1:156533529-156533551 TCAATGAAATGATCTGAAAGAGG - Intronic
915885606 1:159717948-159717970 ACAAAGAGATGATCTGAAATTGG + Intergenic
916325870 1:163559297-163559319 GCAAAGAATTGAGATGAAACCGG + Intergenic
916649375 1:166820490-166820512 GCAAAGAAATGATCTGAAACTGG - Intergenic
916971106 1:170017161-170017183 GCAGAAGAATGACCTGAACCCGG + Intronic
917051786 1:170932533-170932555 GCAAAGAGATGGTCCGAAACTGG - Intergenic
917355649 1:174124185-174124207 GCAAAGAAATGACATAAAACTGG + Intergenic
917696871 1:177534217-177534239 GCAAATAGATGATCTGCAACTGG - Intergenic
918323129 1:183383528-183383550 GCAAAGAGGTTATCTGAAACTGG - Intronic
918437384 1:184529905-184529927 GCAAAGCCATGATCTGAACCAGG - Intronic
918485926 1:185027953-185027975 GCAAAGAGATGATCTGAAACTGG - Intergenic
921621501 1:217330603-217330625 GCAAAGAGATGATGTGAAACTGG - Intergenic
922097821 1:222457708-222457730 GCAAAGAAATGACCTGAAGTTGG + Intergenic
922361641 1:224828161-224828183 GCAGGGGAAAGATCTGAAGCAGG + Intergenic
922448884 1:225720516-225720538 GCAGAAGAATGATGTGAACCTGG + Intergenic
923432421 1:233936163-233936185 GAAAAGGAATGATCTCAGATAGG - Intronic
923941460 1:238832107-238832129 ACAAAGAGATTATCTGAAACAGG + Intergenic
924759305 1:246969167-246969189 GGAAAGAGATTATCTGAAACTGG - Intronic
924793162 1:247271643-247271665 GCAAAGAAATGATCTAAAGTTGG - Intergenic
924936536 1:248776917-248776939 ACAAAGAAATGATCTGAAATTGG + Intergenic
1063317137 10:5017308-5017330 CCAAAGAGATTATCTGAAACTGG - Intronic
1063428481 10:5967501-5967523 GCAAAGGAATGATCTGATCTTGG - Intronic
1063516872 10:6705251-6705273 GCAAAGGAATAAGAAGAAACAGG - Intergenic
1063807138 10:9658461-9658483 GCAACAGAATCTTCTGAAACTGG + Intergenic
1065538752 10:26740046-26740068 GCAGAGGAATCATTTGAACCCGG + Intronic
1066972744 10:42329199-42329221 GCAGAAGAATGGTGTGAAACTGG - Intergenic
1068138587 10:52975843-52975865 GCAATGGAACGATCTAATACTGG - Intergenic
1068154244 10:53176222-53176244 GCAAAGGACATATCTGAAAAGGG + Intergenic
1068163092 10:53293331-53293353 GCAAAGAGATGTACTGAAACTGG + Intergenic
1068284136 10:54912998-54913020 ACAAAGAAATGACCTGAAATTGG + Intronic
1068374734 10:56164335-56164357 ACAAAGAGATGATCTGAAAGTGG + Intergenic
1068449407 10:57166082-57166104 ACAAAGAAATTATCTGAAACTGG - Intergenic
1068580238 10:58731034-58731056 GCAAAGATGTTATCTGAAACTGG - Intronic
1068978580 10:63036799-63036821 GCAAGGGAATGACTTGAACCTGG + Intergenic
1069081121 10:64089085-64089107 GCAAATGACTGATCAGAGACTGG - Intergenic
1069238651 10:66110266-66110288 GCAAGGGAATCATTTGAACCTGG + Intronic
1069462689 10:68610187-68610209 GCAAGAGAATGATGTGAACCCGG + Intronic
1070205381 10:74253858-74253880 GCAAAAGAATCACCTGAACCTGG - Intronic
1070224232 10:74483611-74483633 GCAAAGAGATGATCTGAAACTGG - Intronic
1071042962 10:81336710-81336732 GCAAAGAGATGATCTGACAATGG + Intergenic
1071962687 10:90822490-90822512 GCAAAGAGATGATCTGAAACTGG + Intronic
1072060760 10:91808473-91808495 GCCAAGGAATTATTTTAAACAGG + Intronic
1072358122 10:94632481-94632503 CCAAAGAGATTATCTGAAACTGG + Intergenic
1072468414 10:95689327-95689349 GAAAAGCATTGCTCTGAAACAGG + Intronic
1072568873 10:96641371-96641393 CCAAAGCAGTGATCTGAAAGTGG + Intronic
1072883138 10:99248504-99248526 GCAAAAAAATGATGTAAAACTGG + Intergenic
1073396757 10:103224299-103224321 GCAAAGAAATGACATAAAACTGG - Intergenic
1073825315 10:107313975-107313997 GCAGGGGAATGGTCTGAACCTGG + Intergenic
1074657897 10:115616331-115616353 GCAAAGAAATGACTTGAAACTGG + Intronic
1074790583 10:116882749-116882771 TCAAAGCTATGATTTGAAACTGG + Intronic
1075189941 10:120297790-120297812 GCAAAGAAAGGATCTGATTCTGG - Intergenic
1076155452 10:128201756-128201778 GCAAAAAGATGATCTGAAATTGG + Intergenic
1077557525 11:3232823-3232845 GGAAAGGCACGGTCTGAAACGGG - Intergenic
1077937308 11:6801472-6801494 GTAAAGAAATGATGTGAAATTGG - Intergenic
1078794027 11:14574022-14574044 ACAAAGAAATAACCTGAAACTGG + Intronic
1078978538 11:16505441-16505463 GCAAAGACATAATCTGAAACTGG + Intronic
1079554381 11:21740781-21740803 GCAAAGAAATTATCTGAAGTTGG - Intergenic
1079713617 11:23717682-23717704 ACAAAGAGATTATCTGAAACTGG + Intergenic
1079769664 11:24443982-24444004 TGAAAGAAATGATCTGAAATTGG + Intergenic
1079819412 11:25106114-25106136 GCAAAGATATGCTCTGAAACTGG - Intergenic
1079980907 11:27150504-27150526 GCAAAGATATGGTCTGAAACTGG - Intergenic
1080133270 11:28821496-28821518 TCATAACAATGATCTGAAACAGG + Intergenic
1080750272 11:35144307-35144329 GCGAAAGAATGAGCTGAAGCAGG + Intronic
1080946380 11:36979481-36979503 GGAAAGAAATAATCTGAAACTGG - Intergenic
1081109711 11:39120207-39120229 GCAAAGAGATGATCTGAAACCGG - Intergenic
1081261812 11:40970996-40971018 GCAAAGAAATGACCTGAAACTGG + Intronic
1081359689 11:42160215-42160237 GCACAGGAATCATTTGAACCTGG + Intergenic
1082142959 11:48631058-48631080 GCAAAGAAATGACATGAAACTGG - Intergenic
1082570159 11:54728422-54728444 GCAAAGAAATAACATGAAACTGG - Intergenic
1082616912 11:55371877-55371899 GCACAGAAATGACCTGAAACTGG - Intergenic
1082619404 11:55401365-55401387 GCAAAGAAATGATCTGAAAATGG - Intergenic
1083050688 11:59773874-59773896 GCAAAGGAATCACTTGAATCCGG + Intronic
1083136180 11:60678664-60678686 GCAAAGAGATTATCTGAAACTGG - Intergenic
1083347907 11:62006315-62006337 GCAGAGGAATGGTGTGAACCCGG + Intergenic
1085818773 11:79770296-79770318 ACAAAGAGATGATCTGAAACTGG + Intergenic
1085885632 11:80518449-80518471 GCAAAGAAATTATGTAAAACTGG + Intergenic
1085928473 11:81052316-81052338 GAAAAAGAATGATTTGAACCGGG - Intergenic
1085976416 11:81660636-81660658 GCAAAGAGATGATCTGAAACTGG - Intergenic
1086799453 11:91153126-91153148 GCAAAGAAATGATCTGAAAATGG - Intergenic
1086821646 11:91442979-91443001 ACAAAGTGATGATCTGAAATTGG - Intergenic
1087069259 11:94060807-94060829 GCAATGAAATGATTTTAAACAGG + Intronic
1087171437 11:95053456-95053478 ACAAAGAAATGACCTGAAAGTGG + Intergenic
1087433275 11:98080675-98080697 GCAAAGAAATGACCTGAAACTGG + Intergenic
1087603702 11:100347963-100347985 TCAAAGGCATGATCTGAAAATGG - Intronic
1087708339 11:101520940-101520962 GCAAAGGAATGATCTGAAACTGG + Intronic
1088188996 11:107206046-107206068 ACAAAGAAATGACCTGAAACTGG - Intergenic
1088785055 11:113173930-113173952 GCTAAGGGATGATTTGGAACAGG - Intronic
1090236323 11:125150733-125150755 GCAAAAGAATGGTGTGAACCCGG - Intergenic
1090595413 11:128315497-128315519 ACAAAGAGATGATCTGAAACTGG - Intergenic
1091552785 12:1549556-1549578 GCAAAGACATTATCTGAAACTGG + Intronic
1092265393 12:6976832-6976854 GCAAAGGAGTGCTGTGAAAAGGG + Exonic
1092853153 12:12648714-12648736 GCAAAGAAATGACATAAAACTGG - Intergenic
1093093486 12:14946699-14946721 GCAAAGGAAAGCTCTGGAACAGG - Intronic
1093334076 12:17879144-17879166 GCTAAGAGATGATCTGAAACTGG - Intergenic
1093508894 12:19903461-19903483 GCAAAAGAATGGCATGAAACTGG - Intergenic
1093591355 12:20905457-20905479 ACAAAGAGATTATCTGAAACTGG - Intronic
1094030669 12:26008177-26008199 GCAAGAGAATGATGTGAACCCGG + Intronic
1094379928 12:29831583-29831605 GCAAAGAAATGACATAAAACTGG - Intergenic
1094471433 12:30804945-30804967 GCAAAGAAAAGATCTGAAACTGG - Intergenic
1094634649 12:32213875-32213897 GCAAAAGTATGATGAGAAACAGG - Intronic
1095226787 12:39686791-39686813 GCAAAGAAATGATATAAAACTGG - Intronic
1095639177 12:44467530-44467552 GCAAAGAAATGATCTGAAATTGG + Intergenic
1095682294 12:44992003-44992025 GAAAAGGAATGATGGGAAGCAGG + Intergenic
1095731629 12:45512028-45512050 ACAAAGAAATGGTTTGAAACTGG - Intergenic
1095974122 12:47927654-47927676 AAAAAGGAATGATCTGAAAGAGG + Intronic
1096050944 12:48606777-48606799 GCAAGGAAATGACGTGAAACTGG - Intergenic
1096067467 12:48752600-48752622 GCAAAGGAAAGGACTGATACAGG - Intergenic
1096478270 12:51921824-51921846 GCAAGAGAATGATTTGAACCTGG - Intronic
1096637123 12:52967240-52967262 GCAAAAGAATCACCTGAACCCGG + Intergenic
1096959852 12:55567393-55567415 GCAAATAAATGATATGAAATTGG + Intergenic
1097136800 12:56863983-56864005 GCAAAGAAATGACATAAAACTGG + Intergenic
1097139223 12:56885988-56886010 GCAAAGAGATGATCTGAAACTGG + Intergenic
1097501605 12:60410432-60410454 ACAAAGAAATGAGCTGAAACTGG - Intergenic
1098199318 12:68038041-68038063 GCAAAGAAATCATCTGGAAGGGG - Intergenic
1098559168 12:71852551-71852573 GCAAAGAAATGACCTGAAACTGG - Intronic
1098702997 12:73652801-73652823 GCAAAGAGATTATCTGAAACAGG + Intergenic
1099487704 12:83249002-83249024 GCAAAGAGATGATCTGAAACTGG + Intergenic
1099558888 12:84148272-84148294 GCAAAGAGATTATTTGAAACTGG + Intergenic
1099676319 12:85765107-85765129 GCAAAAGAATCACCTGAACCTGG + Intergenic
1099984602 12:89648537-89648559 GCAAAGGAATGACCTGAAGTTGG + Intronic
1100052226 12:90462221-90462243 GCAAAGGAATGATTTAAAGTTGG - Intergenic
1101259895 12:103018400-103018422 GCAAAGAAATGATCTGAAAGTGG - Intergenic
1101610438 12:106286638-106286660 GCAAAAGAATCATTTGAACCTGG - Intronic
1101793616 12:107953111-107953133 GCAAGAGAATGATGTGAACCCGG - Intergenic
1102045261 12:109825855-109825877 ACAGAGGAAGGATCTCAAACTGG - Intronic
1103106286 12:118229192-118229214 GCAAGAGAATCATCTGAACCTGG - Intronic
1103192657 12:119015423-119015445 GCAGAGGAGTGATATGGAACTGG - Intronic
1103335813 12:120188753-120188775 GCAGAAGAATGATATGAACCCGG + Intronic
1105568772 13:21578928-21578950 GAAACAGAATGCTCTGAAACTGG + Intronic
1105674135 13:22651819-22651841 GCAAAGGAATGATGTGCAGAGGG - Intergenic
1106764287 13:32898272-32898294 GCAGAGGAAGGATTTGAACCTGG + Intergenic
1106960391 13:34990807-34990829 GCAAAGAGATGATCTGAAACTGG - Intronic
1107343791 13:39438365-39438387 GTAAATAAATGAACTGAAACTGG + Intronic
1108300969 13:49075825-49075847 GCACAGGTAGGATCTGAAAGGGG - Intronic
1108512529 13:51169347-51169369 GCAAACAGATGATCTGAAACTGG + Intergenic
1108669965 13:52675948-52675970 CCAAAGCAATGTTCTGAACCAGG - Intronic
1108768322 13:53663084-53663106 ACAAAGATATGATATGAAACTGG + Intergenic
1108956736 13:56167287-56167309 ACATAGAAATGAACTGAAACTGG - Intergenic
1109485307 13:63010554-63010576 GCAAAGAGATTATCTGAAACAGG - Intergenic
1109503658 13:63270616-63270638 GCAAAGGAATGACTTAAAACTGG - Intergenic
1109857896 13:68156852-68156874 GCAAATAAATGACCTGAAACTGG - Intergenic
1109962007 13:69644004-69644026 AGAAAGAAATGACCTGAAACTGG + Intergenic
1110033791 13:70653757-70653779 GCAAAGAAATGACCTAAAATTGG + Intergenic
1110421361 13:75313115-75313137 GCTAAGGAATGAGTAGAAACAGG - Intronic
1110440492 13:75520761-75520783 GCAAAGAAATGATATGAAACTGG + Intergenic
1110868645 13:80424502-80424524 GCAAAGAAATGACCTGAAACTGG - Intergenic
1110901900 13:80834724-80834746 GCAAAGAATTGACTTGAAACTGG - Intergenic
1111008567 13:82282024-82282046 GCAAAGAAATGACCTGAAACTGG - Intergenic
1111040192 13:82738376-82738398 GCAAGAGAATGATGTGAAGCTGG - Intergenic
1111221266 13:85208108-85208130 ACAAAGAGATTATCTGAAACTGG + Intergenic
1111442877 13:88304014-88304036 ACAAAGAAATGACCTGAAATTGG + Intergenic
1111538813 13:89643139-89643161 GCAAAGTATTTATCTGAAAAGGG - Intergenic
1113203149 13:107888615-107888637 GCAAAGAAATGACCTGAAACTGG - Intergenic
1113284159 13:108828370-108828392 GCAGAGCCAGGATCTGAAACTGG - Intronic
1113320715 13:109229452-109229474 ACAAAGAGATGATCTAAAACTGG - Intergenic
1113501943 13:110782632-110782654 ACAAAGAGATGATCTGAAATTGG - Intergenic
1114347939 14:21816786-21816808 GCAAAGAAAGGATCTGAAATTGG - Intergenic
1115289323 14:31752295-31752317 ACAAAGAGATGATCTGAAATTGG - Intronic
1115944351 14:38643337-38643359 ACAAAGAGATGATCTGAAATTGG + Intergenic
1116046709 14:39752384-39752406 GCAAGGGAATGGTGTGAACCCGG + Intergenic
1116427767 14:44811042-44811064 GGAAAGTGATGATCTGAAAGGGG - Intergenic
1116713250 14:48396665-48396687 GCAAAGAGATGAACTAAAACTGG + Intergenic
1116998182 14:51346240-51346262 ACAAAGAGATTATCTGAAACTGG + Intergenic
1117076438 14:52109513-52109535 GCAAGGGAATGGTGTGAACCTGG + Intergenic
1117241443 14:53837770-53837792 ACAAAGAGAGGATCTGAAACTGG - Intergenic
1118542195 14:66840800-66840822 GAATAGGAATGTTCTAAAACAGG - Intronic
1119764707 14:77181271-77181293 GCAAAGGAGTGATCTACAATTGG - Intronic
1119969514 14:78953834-78953856 GGAAAGTTATGATCTGCAACTGG - Intronic
1120101486 14:80450308-80450330 ACAAAGAGATGATCTGAAACTGG + Intergenic
1120117909 14:80641994-80642016 GCAGAAGAATGATGTGAACCCGG + Intronic
1120225788 14:81789923-81789945 ACAAAGAGATGATCTGAAATTGG + Intergenic
1120257658 14:82140827-82140849 ACAAAGAAATGACCTGAAACTGG + Intergenic
1120407001 14:84102919-84102941 GCAAAGAAATGAGGTAAAACTGG + Intergenic
1120425369 14:84341120-84341142 GCCAAGGAATGGTCTGAGTCAGG - Intergenic
1120583171 14:86279391-86279413 GCAAAGACATGACCTGAAACTGG + Intergenic
1121215604 14:92245250-92245272 GCAAAGGAATGACCTAAAGGTGG - Intergenic
1122004385 14:98690009-98690031 GCAAAGGCAATTTCTGAAACAGG - Intergenic
1122526311 14:102387618-102387640 GCAGGAGAATGATGTGAAACCGG - Intronic
1123626980 15:22234059-22234081 GCAGGGGAATGATGTGAACCTGG - Intergenic
1125119589 15:36138371-36138393 GCAAAAGAATGGTGTGAACCCGG + Intergenic
1125251736 15:37712984-37713006 GCAAAGAAAATATCTGAAATGGG + Intergenic
1125274489 15:37976877-37976899 GCAGAGGAATCATTTGAACCTGG - Intergenic
1125680841 15:41529356-41529378 GCAAAGGCATGAACTAGAACAGG + Intronic
1125730872 15:41892273-41892295 GCAAAGGGATCATTGGAAACCGG - Intronic
1126488585 15:49211085-49211107 GCAAAGAAATGACCTGAAACTGG - Intronic
1126929452 15:53631893-53631915 GAAAAGAAATGACCTGAAATTGG + Intronic
1127137809 15:55943147-55943169 TCACAGAAATGATCTGAAACTGG + Intronic
1127779488 15:62298807-62298829 GCAAAAGAATGGTTTGAACCAGG + Intergenic
1127897707 15:63316978-63317000 GCCAAGGAATCACCTGAACCTGG - Intergenic
1128029676 15:64468773-64468795 GCACAGTAATGATCAGAATCTGG - Intronic
1128692212 15:69733406-69733428 GCAAAGGAAGGAAGTAAAACAGG - Intergenic
1131090778 15:89623500-89623522 CCAAAGGAATGATCTAAAGATGG - Intronic
1132626418 16:893766-893788 GTGAAGGAATCATCTGAAGCCGG - Intronic
1133356568 16:5141345-5141367 GCAAGGGAATCATTTGAACCCGG - Intergenic
1133386179 16:5372067-5372089 GCAAAGGAAATATCTGAAGCCGG - Intergenic
1133451551 16:5908444-5908466 GCAGAAGAATCACCTGAAACCGG - Intergenic
1133795831 16:9045411-9045433 GCAGAGGAATCATTGGAAACCGG + Intergenic
1135433706 16:22409995-22410017 GCAAAAGCAGGATCTGAAAAAGG - Intronic
1136171195 16:28490664-28490686 GCAAAAGAATGGTGTGAACCTGG + Intronic
1136330618 16:29573821-29573843 GCAAAGGAATCATTTGAACCCGG + Intergenic
1137358731 16:47792525-47792547 ACAAAGAAATGACCTGAAATTGG - Intergenic
1138109788 16:54314526-54314548 GCAAGAGAATGGTCTGAATCTGG - Intergenic
1138615420 16:58161686-58161708 GAAAAGAGATGGTCTGAAACTGG + Intronic
1138800176 16:60017146-60017168 ACAAAGGGATGATTTGAAATTGG - Intergenic
1139166833 16:64576335-64576357 GCAAAGGAAGGATCTGTTCCAGG - Intergenic
1139623982 16:68170295-68170317 GCAAAGGAATCACTTGAACCTGG + Intronic
1139891565 16:70256396-70256418 GCAAGAGAATCATTTGAAACTGG - Intronic
1140140154 16:72248402-72248424 GCAAAGCAATGATATGGACCTGG + Intergenic
1140721287 16:77774681-77774703 GAAAAGGAATGAAAAGAAACAGG - Intergenic
1141272843 16:82556554-82556576 GCAAAGACATGACCTGAAACTGG - Intergenic
1141707293 16:85673968-85673990 GCACAGGAACGGTCAGAAACTGG + Exonic
1141748009 16:85938969-85938991 TCAAAGGAATGTTCTGCAAATGG - Intergenic
1142281273 16:89149056-89149078 GCAAAGAGATGACCTGAAACCGG - Intronic
1142543327 17:679083-679105 ACAGAGTAATGAACTGAAACAGG + Intronic
1143305565 17:5943904-5943926 GCAAAGGCAGAATTTGAAACTGG - Intronic
1144368882 17:14571004-14571026 GCAAAGAAATGACCTGAAATTGG - Intergenic
1145022503 17:19442825-19442847 GCAAATAAATGAGCTGAAACTGG + Intergenic
1146391719 17:32429295-32429317 GCAAAGAGATTATCTGAAACTGG + Intergenic
1147244883 17:39113440-39113462 GCAAGGGGATGATGTGGAACAGG - Intronic
1149140530 17:53428055-53428077 ACAAAGAAATGACCTTAAACGGG + Intergenic
1149178295 17:53901872-53901894 ATAAAGAAATGATCTGAAACTGG + Intergenic
1149739893 17:59035151-59035173 GCACAAGAATCATTTGAAACTGG - Intronic
1150316566 17:64174284-64174306 GCAAAGGAAGGACCTGAGACAGG + Intronic
1150350286 17:64438951-64438973 ACAAAGGGATAATCTGAAATTGG - Intergenic
1150550129 17:66202704-66202726 GCAGAAGAATGATGTGAACCGGG - Intergenic
1153556831 18:6323696-6323718 GCAAAGATATGACCTGAAATTGG + Intronic
1154155299 18:11939633-11939655 GCACAGGAATCATTTGAACCTGG - Intergenic
1155051379 18:22150865-22150887 GCAAGAGAATGATTTGAACCCGG - Intergenic
1155707910 18:28838738-28838760 GCCAAGAGATGATCTGAAACTGG - Intergenic
1156151662 18:34250437-34250459 ACAAAGAGATGATCTGAAACTGG - Intergenic
1156533086 18:37836752-37836774 ACAAAGGAAACATCTGAAGCAGG + Intergenic
1156683477 18:39618090-39618112 GCAAAGAGATTATCTGAAACTGG - Intergenic
1156914438 18:42448397-42448419 GCAAAGAGATTATCTAAAACTGG - Intergenic
1157020585 18:43776619-43776641 GAAAAGGAATGAAGTGAGACTGG - Intergenic
1157206415 18:45703856-45703878 GCAAAGAAACAACCTGAAACTGG - Intergenic
1157816824 18:50735594-50735616 GCATAGGAATGTTCAGATACTGG - Intergenic
1158092252 18:53727891-53727913 GTAACGAGATGATCTGAAACTGG - Intergenic
1158289698 18:55926007-55926029 GGAAAGAAATAATCAGAAACAGG + Intergenic
1158763263 18:60415732-60415754 GCAAGAGAATGGTGTGAAACCGG + Intergenic
1159071180 18:63625344-63625366 ACAAAGAGATTATCTGAAACTGG - Intergenic
1159550595 18:69892047-69892069 GCTGAGGAATGACATGAAACAGG - Intronic
1159649313 18:70958569-70958591 GAACAGGAATAATCTGAAATAGG - Intergenic
1160051466 18:75438051-75438073 GGAATGGCATGATCTGACACAGG + Intergenic
1160366752 18:78332821-78332843 GCAAAGGAATGGGATGACACAGG - Intergenic
1161149012 19:2697113-2697135 TCACAGGAATGTTCTGAAAGGGG + Intronic
1161578841 19:5069705-5069727 GCAAAAGAATCATTTGAACCTGG - Intronic
1162067364 19:8134146-8134168 GCAGGGGAATGATGTGAACCCGG + Intronic
1163030476 19:14540926-14540948 GCAAAAGAATGGCTTGAAACCGG - Intronic
1164399652 19:27893860-27893882 GGAAAGGAAGGATCTGACTCAGG - Intergenic
1165969364 19:39613557-39613579 AAAAAGAGATGATCTGAAACTGG + Intergenic
1166211705 19:41310573-41310595 GGAAAGGATTGGTCTGGAACTGG - Intronic
1166424739 19:42667608-42667630 ACAAAGGAATGAGCAGAGACAGG + Intronic
1166624079 19:44334324-44334346 GCAAAGAGATTATCTGAAACTGG + Intronic
1166631752 19:44412703-44412725 ACAAATGACAGATCTGAAACTGG - Intergenic
1166636426 19:44455918-44455940 ACAAATGACAGATCTGAAACTGG + Intergenic
1167134093 19:47607035-47607057 GCAAAGGCAGGATATGAACCAGG + Intergenic
1167944294 19:52975186-52975208 GCAAAAGAATCACTTGAAACTGG + Intergenic
925061701 2:896628-896650 GCAAAGAAATGACCTGAAACTGG + Intergenic
925393051 2:3512052-3512074 GCAAAGGAATGACCTGAAGTTGG + Intronic
926067938 2:9859107-9859129 ACAAAGAGATTATCTGAAACTGG - Intronic
926319819 2:11741715-11741737 GCAAGAGAATGATGTGAACCTGG + Intronic
926461521 2:13135705-13135727 GCAAAGGAATGATCTAAAGGTGG + Intergenic
927033847 2:19151188-19151210 GCAAATAAATGACCTGAAACTGG - Intergenic
929081525 2:38127211-38127233 ACAAAGAAATGACCTGAAAAGGG + Intergenic
929252127 2:39769606-39769628 GCAAAAGAATCACCTGAACCTGG + Intronic
929612709 2:43283750-43283772 ACAAAGAGATTATCTGAAACTGG + Intronic
929967487 2:46546196-46546218 GCAAAGGAATGAATTTAAAATGG + Intronic
930178483 2:48325940-48325962 GCACAAGAATCATCTGAACCTGG - Intronic
930312388 2:49757539-49757561 GCACAGGAATCATTTGAACCCGG + Intergenic
930686370 2:54312777-54312799 GCAAAAGCATGATGGGAAACAGG - Intergenic
931145286 2:59509804-59509826 GAAGAGGAATGAGCTGATACAGG + Intergenic
931220043 2:60281018-60281040 GCAAAAGTATGATGGGAAACAGG + Intergenic
933070825 2:77856651-77856673 GCAAATAAATGACCTGAAACAGG + Intergenic
933521501 2:83380591-83380613 GCAAAGAGATGATTTGAAACTGG + Intergenic
933711726 2:85331339-85331361 GCAGAAGAATCATCTGAACCCGG - Intergenic
933985747 2:87590972-87590994 ACAAAGAAATGATCTGAAATTGG + Intergenic
935324525 2:101924464-101924486 GCAAAGAAATGATCTGAAACTGG + Intergenic
935716082 2:105940174-105940196 GCAAGGGAATGGTGTGAACCTGG - Intergenic
935798665 2:106670786-106670808 GCAAAGACATGATCTGAAATGGG + Intergenic
936308095 2:111359832-111359854 ACAAAGAAATGATCTGAAATTGG - Intergenic
937493118 2:122390100-122390122 ACAAAGAGATGATCTGAAATGGG - Intergenic
937841295 2:126527065-126527087 GCAAAAGAATGACCTAAAGCTGG - Intergenic
937995497 2:127691140-127691162 GCAAAGAAATGACCTGAACCTGG - Intergenic
938031804 2:128001067-128001089 GCTAAGGAATGATGTAAAATTGG - Intronic
938541260 2:132285972-132285994 ACAAATGACAGATCTGAAACTGG + Intergenic
938622581 2:133071878-133071900 GCAGAGGTGGGATCTGAAACAGG - Intronic
939053796 2:137337600-137337622 GTAAAAGAATGATAAGAAACAGG - Intronic
939179189 2:138784295-138784317 GCAGAGTAATGAACTGGAACAGG - Intergenic
939247653 2:139645935-139645957 CCAAATGGATGAGCTGAAACTGG - Intergenic
939714205 2:145562644-145562666 GCAAAACAATGATGGGAAACAGG - Intergenic
939754677 2:146094702-146094724 GCAAAGAGATTATCTGAAACTGG - Intergenic
939835491 2:147125129-147125151 ACAAAGAAATGACCAGAAACTGG + Intergenic
940121968 2:150277168-150277190 GCAAATAAATTATCTGAAATTGG - Intergenic
940524738 2:154799223-154799245 GCATAGGAATCATTTGAACCTGG - Intronic
940729857 2:157376039-157376061 GCAAAAAAACGACCTGAAACTGG - Intergenic
941209585 2:162620823-162620845 GCAAAGGAATTATGTGACAGAGG - Intronic
941320249 2:164046016-164046038 GCAAAAGTATGATGAGAAACAGG + Intergenic
941431922 2:165423497-165423519 GCAAAGAAATGTCTTGAAACTGG - Intergenic
941816887 2:169804637-169804659 GCAGAAGAATCATTTGAAACCGG - Intronic
942054693 2:172171762-172171784 GCACAGGAATCATTTGAACCCGG - Intergenic
942203322 2:173593546-173593568 ACAAAGAGATTATCTGAAACTGG - Intergenic
943303213 2:186229482-186229504 GCAAAGAAATGACCTGAAACTGG + Intergenic
943481625 2:188427182-188427204 GCAAATAAATGATGTAAAACTGG + Intronic
944491452 2:200262417-200262439 GCAAAGAAATGATGTGAAATTGG + Intergenic
945084545 2:206117968-206117990 GCAAATATATGATCTGAGACTGG - Intronic
945136083 2:206628856-206628878 GCAAAAGAATGATTTTAAAAAGG + Intergenic
945172820 2:207014388-207014410 GAATTGGCATGATCTGAAACAGG - Intergenic
945356224 2:208843009-208843031 GCAAAGAGATGATCTGAAACTGG + Intronic
945358428 2:208866265-208866287 GCATAGGAATCATTTGAACCTGG + Intergenic
945533993 2:210989365-210989387 GCAAAGAAATGTCCTGAAACTGG + Intergenic
946317217 2:218924291-218924313 ACAAAGAGATGATCTGAAACTGG - Intergenic
946342464 2:219079668-219079690 CCTGAGGAATGAACTGAAACAGG + Intronic
946403012 2:219478523-219478545 GCCAAGTATTGATCTGAAATGGG - Intronic
946507240 2:220314803-220314825 GCAAAGAAATGAAAGGAAACAGG - Intergenic
946804974 2:223462947-223462969 ACAAAGAAATGACCTGAAACTGG + Intergenic
946937314 2:224735794-224735816 ACAAAGAGATTATCTGAAACTGG + Intergenic
946963412 2:225009723-225009745 CCAAAGCAATGAACTGAAACTGG + Intronic
946990037 2:225318377-225318399 GCAAAGAGATGATCTAAAACTGG + Intergenic
947488502 2:230574037-230574059 GCAAAAAGATGATCTGAAATGGG - Intergenic
948104168 2:235399843-235399865 GCAAAGAGATGATCTGAAACTGG + Intergenic
1168988355 20:2071125-2071147 GCAAGAGAATCATTTGAAACTGG + Intergenic
1170529042 20:17271062-17271084 GTAAAGGAAGGATCACAAACTGG - Intronic
1171870168 20:30518994-30519016 ACAAATGACAGATCTGAAACTGG + Intergenic
1172466238 20:35156882-35156904 GCAAAAGAATCATTTGAATCTGG - Intergenic
1174410924 20:50334776-50334798 GCACAGGAATCATTTGAACCTGG + Intergenic
1175881456 20:62261850-62261872 GCAAGAGAATCATCTGAACCTGG - Intronic
1177169649 21:17641009-17641031 GCAAAGAAATGACCTGAAATCGG - Intergenic
1177186961 21:17807888-17807910 ACAAAGAGATGATCTGAAACTGG + Intronic
1177312233 21:19412746-19412768 GCAAAGAGATAATCTGAAACTGG + Intergenic
1177391261 21:20475771-20475793 GCAGAGGAATGGTGTGAACCTGG + Intergenic
1177493679 21:21861673-21861695 CCTAAGGAATGAACTGATACAGG - Intergenic
1177517609 21:22176036-22176058 GCAAAGAGATGATCTGAAACTGG + Intergenic
1177722611 21:24927686-24927708 GCAAAAAAATGACCTGAAACTGG + Intergenic
1177969786 21:27776024-27776046 TCTAAGGAAATATCTGAAACTGG + Intergenic
1178154274 21:29832927-29832949 GCAAATAAGTGATCTGGAACTGG - Intronic
1181142735 22:20818980-20819002 ACAAAGGAATGAGAAGAAACAGG + Intronic
1181448713 22:23001209-23001231 GTAAAGAGATGATCTGAAACTGG - Intergenic
1181529180 22:23506700-23506722 GCAAAAGAATGGTGTGAACCTGG + Intergenic
1182023158 22:27098049-27098071 GCAGAGGCAGGATCTGAACCCGG + Intergenic
1183039077 22:35162596-35162618 GGAAATGAATGATCTCAAGCTGG + Intergenic
1184207121 22:43012269-43012291 GCAGAGGAATCATTTGAACCTGG + Intronic
949331966 3:2932914-2932936 GCAAGAGAATGATGTGAACCCGG - Intronic
950392568 3:12708195-12708217 GCACAGGAATCATTTGAACCTGG - Intergenic
950956006 3:17054053-17054075 GAAGAGAAATGACCTGAAACTGG - Intronic
950972390 3:17202348-17202370 GCAAAGAGATGATCTGAAACTGG + Intronic
951181167 3:19660978-19661000 GCAGAAGAATCATCTGAACCTGG - Intergenic
951449437 3:22819659-22819681 GCAAAAAAATGACCTGAAACTGG - Intergenic
951936968 3:28032855-28032877 GCAAAGAAATGAGGTAAAACTGG + Intergenic
952221469 3:31327798-31327820 GCAAAGAAATGACCTGAAACTGG - Intergenic
952326700 3:32326608-32326630 GCAAGAGAATCATCTGAACCTGG - Intronic
952735113 3:36681405-36681427 ACAAAGAAATGACCTGAAACTGG - Intergenic
953182608 3:40610311-40610333 GCAAAGGAATGAGCAGAATTAGG + Intergenic
953499369 3:43418181-43418203 GCAGGGGAATCGTCTGAAACTGG + Intronic
953720794 3:45353298-45353320 GCAAAAGAGTGATGAGAAACAGG - Intergenic
953835510 3:46339542-46339564 TCAAAGAAATGACCTGCAACTGG - Intergenic
954125051 3:48523288-48523310 GCAAGAGAATCATCTGAACCCGG + Intronic
954985747 3:54790130-54790152 GCAAAGCAAGCATTTGAAACCGG - Intronic
955995079 3:64672177-64672199 TCATAGGAACCATCTGAAACTGG - Intronic
956250554 3:67230212-67230234 GCAAAGGAAAGAACATAAACAGG - Intergenic
956252892 3:67253329-67253351 ACAAAGAGATGATCTGAAATTGG + Intergenic
957293355 3:78306161-78306183 GCAAAGGGGTGATCTGAAACTGG + Intergenic
957403064 3:79742035-79742057 ATAAAGAGATGATCTGAAACTGG + Intronic
957506774 3:81131542-81131564 GCAAAGAGATTATCTGAAGCTGG + Intergenic
957588767 3:82168108-82168130 GGAAATAAATGATCAGAAACTGG - Intergenic
957746357 3:84347982-84348004 GCAAAGAAATGACCTGAAATTGG - Intergenic
958039538 3:88209529-88209551 GCAAATGAATGATCTGTTTCAGG + Intergenic
958256512 3:91331723-91331745 GCAAAGAAATGATCTGAAACTGG + Intergenic
958474848 3:94568365-94568387 ACAAAGAGATTATCTGAAACTGG + Intergenic
958784436 3:98582348-98582370 GATAAGAAATGATCTGAAAGGGG - Intronic
958954775 3:100455752-100455774 GAAAGGGAAAGATCAGAAACAGG - Intronic
959149400 3:102590817-102590839 GCAAAGAAATAATCTGCAACTGG + Intergenic
959245461 3:103862409-103862431 GCAAAGAAATGATGTAAAACTGG + Intergenic
960237309 3:115298632-115298654 GAAATGGAATGATCCGAAAGGGG - Intergenic
961266880 3:125650277-125650299 CAAAAAGAATGGTCTGAAACTGG + Intergenic
961314915 3:126028001-126028023 GCAAAGAAATGATGCAAAACTGG + Intronic
961768739 3:129232536-129232558 GCAAAAGAATGGTGTGAACCTGG - Intergenic
962473405 3:135733592-135733614 TCAAAGGAAAGCTCTGAACCTGG - Intergenic
963422975 3:145086155-145086177 ACAAAGGAAAGATCTAAAACAGG - Intergenic
963510078 3:146236005-146236027 GCAAAGAAATGACCTAAAACTGG + Intronic
963777389 3:149452727-149452749 GCAAAGAAATGATGTAAAACTGG - Intergenic
964092746 3:152895377-152895399 GCAAAAGAATCACCTGAAACCGG + Intergenic
964140404 3:153392136-153392158 GCAGAAGAATGATGTGAACCCGG + Intergenic
964154072 3:153563886-153563908 GCAAAGAGATGATTTGAAACTGG + Intergenic
964425716 3:156551750-156551772 GCAAAGAAATGATCAAAATCAGG + Intronic
964545492 3:157829115-157829137 GCAAAGAAATGACCTAAAAGTGG - Intergenic
964629330 3:158792902-158792924 GCAAAGGGATGATTTCATACTGG - Intronic
965290454 3:166872479-166872501 GCAAAGAAATGATCTGAAACTGG + Intergenic
965326439 3:167309951-167309973 ACAAAGAAATGGTATGAAACTGG - Intronic
965362603 3:167760060-167760082 TCAAAGGTATGATGAGAAACAGG - Intronic
965394966 3:168152350-168152372 ACAAAGAGATCATCTGAAACTGG + Intergenic
965397346 3:168174954-168174976 GCAAAGAAATAATCTGAAACTGG - Intergenic
966075804 3:175935863-175935885 GCAAAGAAATGATGTAAAATTGG + Intergenic
966097817 3:176227779-176227801 GCAAAGAAATGACCAAAAACTGG + Intergenic
966302623 3:178496359-178496381 ACAAAGAGATTATCTGAAACTGG + Intronic
967803034 3:193685206-193685228 GCAGAAGAATCATTTGAAACCGG + Intronic
967888877 3:194351144-194351166 GCTGCGGAATGCTCTGAAACGGG + Intronic
968396668 4:244581-244603 GCAAAGGAACGATTAGAAAAGGG + Intergenic
968827874 4:2912936-2912958 GCAAAGGAATCACCTGAACGTGG - Intronic
969107909 4:4821931-4821953 GCAAAGAGATCATCTGAAACTGG + Intergenic
969198366 4:5581628-5581650 GCAAAGAAATGACCTGAAACTGG + Intronic
969997005 4:11323737-11323759 GCAAAGAAATTACCTAAAACTGG + Intergenic
970150346 4:13082554-13082576 ACAAAGAGATTATCTGAAACTGG - Intergenic
970468501 4:16351959-16351981 GCAAAGGATTGGGCTGGAACTGG - Intergenic
970923813 4:21426934-21426956 GAATGGGAATGATCTGAAAAAGG - Intronic
971274211 4:25180414-25180436 GAAAAGGAATAATCTGTAAGAGG + Intronic
971545524 4:27880496-27880518 GCAAAGAAATGAACTGAAACTGG - Intergenic
971593543 4:28498447-28498469 ACAAAGAGATGATCTGAAATTGG - Intergenic
971908549 4:32762580-32762602 GGACAGGAATGATGTGTAACAGG + Intergenic
972096293 4:35350782-35350804 GCAAAGAGATGGTCTGAAATTGG - Intergenic
972113925 4:35603855-35603877 GCAAAAGAATCATTTGAACCTGG + Intergenic
972359459 4:38314111-38314133 GCAAAGGAAATGTCTGAAACTGG - Intergenic
972367726 4:38392162-38392184 GCAAAGAAATGACCTGAAATTGG + Intergenic
972881903 4:43434882-43434904 GCAAAGGTAATATCTGAAAAGGG + Intergenic
972930214 4:44063330-44063352 GCAAAGGAATGACCTAAATTTGG + Intergenic
973571604 4:52245568-52245590 GAAAAGGTAAGATTTGAAACTGG - Intergenic
974004440 4:56542125-56542147 GCAGAGGAATGATCTGCCTCAGG + Intronic
974573650 4:63688665-63688687 ACAAAGAAATTATCTGAAACTGG + Intergenic
974603994 4:64125196-64125218 ACAAAGGAAAGATTTGCAACTGG - Intergenic
974637940 4:64589939-64589961 GTAAAGAAATGACATGAAACTGG + Intergenic
974816047 4:67004472-67004494 GGAAAGGAATGATATAAAAGTGG - Intergenic
974931377 4:68364999-68365021 ACAAAGAGATGATCTGAAATTGG + Intergenic
975150754 4:71018218-71018240 GCACAAGAATGATGTGAACCTGG - Intronic
975554538 4:75648252-75648274 GCAAGGGAATCATTTGAACCCGG + Intronic
976000853 4:80371510-80371532 GCAAAGACATAATCTAAAACTGG - Intronic
976141908 4:82001914-82001936 GCAAAGCGATGTTTTGAAACTGG + Intronic
976828724 4:89289022-89289044 ACAAAGGGATGATCTGAAAGTGG - Intronic
976842334 4:89446022-89446044 GCAAAGAGATGATCTGAAACTGG - Intergenic
977045952 4:92069885-92069907 GCAAAGAAATGACATAAAACAGG + Intergenic
978267147 4:106839876-106839898 GCAAAGAAATGACCTGAAACTGG - Intergenic
978492522 4:109323821-109323843 ACAAAGAGATGATCTGAAACTGG - Intergenic
979087142 4:116427876-116427898 GCTAAGAGATGATCTGAAACTGG + Intergenic
979184137 4:117767010-117767032 GAAAACGAATGATGTGAATCTGG - Intergenic
979373313 4:119914867-119914889 GCAAAGAGATGATCTGAAAATGG - Intergenic
979420809 4:120502873-120502895 GCAAAGAGATGATTTGAAACTGG - Intergenic
979721393 4:123904763-123904785 GCAAAGAAATGGTCTAAAATTGG + Intergenic
980153780 4:129080322-129080344 GCAAAGAGATGGTCTGAAACTGG - Intronic
980250619 4:130310116-130310138 GCAAAAGAATCATTTGAACCCGG - Intergenic
980287673 4:130801927-130801949 CCTAAGGAATTATATGAAACCGG - Intergenic
980458218 4:133072815-133072837 GCAAAGACTTGACCTGAAACTGG + Intergenic
980458686 4:133076828-133076850 GCAAAGAGATGATCTGAAACTGG - Intergenic
980663535 4:135899015-135899037 GCAAAGGAATGATATAAAGTTGG + Intergenic
980702746 4:136454395-136454417 GCAAAGAGATGATCTGAAATTGG + Intergenic
980823003 4:138040509-138040531 ACAAAGGAATGCTTTGCAACAGG - Intergenic
981131299 4:141161388-141161410 GCAAAGAAATGACCTAAAATTGG + Intronic
981191809 4:141872866-141872888 ACAAAGAGATGATCTGAAATTGG - Intergenic
981260001 4:142708202-142708224 GCAAAGAGATGATCTGAAACTGG + Intronic
981515500 4:145604800-145604822 GCAAAGGCATGACATGAAGCTGG - Intergenic
982428920 4:155299098-155299120 GGAAAGAAATGACCTGAAACTGG - Intergenic
982505954 4:156218437-156218459 GCAACGAAATGACCTGAAACTGG + Intergenic
982797640 4:159664574-159664596 ACAAAGAGATGATCTGAAATTGG - Intergenic
982805189 4:159754732-159754754 GCAAAGAGATGGTCTGAAATTGG + Intergenic
983075237 4:163317508-163317530 GCAAAGAAATGACATGAAACTGG - Intergenic
984842591 4:184082037-184082059 GCAAAGGCAAGATCTGAACAAGG - Intergenic
985386318 4:189451902-189451924 GCAAAGAAATGATCTGAAACAGG + Intergenic
985565706 5:615227-615249 GCAGAGGAATCATGTGAACCCGG - Intronic
986099663 5:4595663-4595685 ACAAAGAAATGACCTGAAACTGG + Intergenic
986345323 5:6829638-6829660 GCAGAGCAATGAAGTGAAACTGG + Intergenic
986837066 5:11650862-11650884 GCAAATAGATGATCTGAAACTGG + Intronic
986900134 5:12421339-12421361 ACAAAGAGATGATCTGATACTGG + Intergenic
986949997 5:13071362-13071384 GCAAAGAGATAATGTGAAACTGG - Intergenic
987488500 5:18549154-18549176 ACAAAGAGATGATCTGAGACTGG - Intergenic
987492153 5:18594692-18594714 ACAAAGAAATGACCTGTAACTGG - Intergenic
987542690 5:19276100-19276122 GAAAAGAAATTACCTGAAACTGG + Intergenic
988147604 5:27330641-27330663 ACAAAGAAATGGTCTGAAATTGG + Intergenic
988448174 5:31311102-31311124 ACAAAGAGATGATGTGAAACTGG - Intronic
988474208 5:31568301-31568323 GCAAGAGAATCATTTGAAACTGG + Intergenic
988720044 5:33868656-33868678 GCAAAGAAATGACTTGGAACTGG + Intronic
989695815 5:44199869-44199891 ACAAAGAAATGACCTGAAACTGG + Intergenic
989764048 5:45057927-45057949 GCAAACTAATTATCTGAATCTGG + Intergenic
989817064 5:45749749-45749771 TATAAGGAATGATCTGAGACTGG + Intergenic
990643318 5:57814003-57814025 GAAAAGGAAAGATTTGATACAGG + Intergenic
991204766 5:64038214-64038236 GCAAAGAAATGACCTGAAACTGG + Intergenic
991478355 5:67048264-67048286 TCAAAGGAATAATCTAAAAAGGG + Intronic
991631467 5:68660667-68660689 GGAAAGGCATGATGGGAAACTGG + Intergenic
992448435 5:76854605-76854627 GCAAAGAAATGACCAGAAACTGG + Intronic
992680065 5:79144515-79144537 GCAAAGGAATGATCTTGAATTGG - Intronic
992768610 5:80026458-80026480 GAAAAGGCATGATCTAGAACAGG + Intronic
993084665 5:83348816-83348838 ACAAAGAAATGACCTGAAATTGG - Intronic
993190054 5:84670074-84670096 GCAATGAAATGATGTAAAACTGG + Intergenic
993253176 5:85554140-85554162 ACAAAGATATGATCTGAAATTGG - Intergenic
993334794 5:86644721-86644743 GCAAATGAATGATTTAAAATTGG + Intergenic
994048082 5:95331557-95331579 CCAAAGGAATGATTTGGAAGTGG + Intergenic
994073819 5:95629340-95629362 GCAAATAAATGACCTGAAACTGG - Intergenic
994137296 5:96302528-96302550 ACAAAGAAATGACCTGAAAGTGG - Intergenic
994283630 5:97937809-97937831 ACAAAGAAATGACCTAAAACTGG + Intergenic
994285096 5:97955429-97955451 ACAAAGAAATGACATGAAACTGG + Intergenic
994546675 5:101176270-101176292 GCAAAGAAATGAACTGAAACTGG + Intergenic
994592300 5:101788769-101788791 ACAAAGAGATGATCTGAAATTGG + Intergenic
994840783 5:104922853-104922875 GCAAAGAAATGACCTAAAATTGG + Intergenic
994935989 5:106254747-106254769 GCAAAAAAATGACCTGAAATTGG + Intergenic
995132682 5:108647237-108647259 GTAAAGAAATGATCTGAAACTGG + Intergenic
996144516 5:119957506-119957528 GCTATGGAATGATCTGGAGCAGG + Intergenic
996157037 5:120114950-120114972 GCAAAGAGATGGTCTGAAACTGG + Intergenic
996537865 5:124596986-124597008 GTAAAGCAATGATCTGAGACAGG - Intergenic
996713568 5:126567875-126567897 GCAAGAGAATGGTCTGAACCCGG - Intronic
996765970 5:127034251-127034273 GCAAAGGAATCACCTGAACTTGG - Intergenic
997016286 5:129938500-129938522 ACAAAGAGATTATCTGAAACTGG - Intronic
997159546 5:131593849-131593871 ACAAAGAGATTATCTGAAACTGG + Intronic
997744527 5:136287480-136287502 GCAATGGAATGATCTGCATTTGG - Intronic
999068274 5:148715594-148715616 GCAAAGAGATTATCTGAAACTGG + Intergenic
999571548 5:152925319-152925341 GCAAAGAAATGACCTGAAACTGG + Intergenic
999906090 5:156142792-156142814 GCAAATAAATGACCTGAAACTGG + Intronic
1000859483 5:166439137-166439159 ACAAAGGGATGATTTGAAATGGG + Intergenic
1001796700 5:174508230-174508252 GCAAAGGTATGCTGTGAAAGGGG + Intergenic
1001944538 5:175767715-175767737 GCAAAGAAATGACCTGAAACTGG - Intergenic
1002375959 5:178789353-178789375 GCAAAGGGCTGATGTGAGACTGG - Intergenic
1002787556 6:415302-415324 ACAAAGAAATAACCTGAAACTGG + Intergenic
1003000157 6:2324747-2324769 GCAAACAAATGACCTGAAACTGG + Intergenic
1003838273 6:10093982-10094004 ACAGAGAAATGGTCTGAAACTGG - Intronic
1004587511 6:17016337-17016359 GCAAGAAAATGGTCTGAAACCGG - Intergenic
1005501734 6:26434613-26434635 GCCATGGAATGATCTGATGCTGG + Intergenic
1005513938 6:26536997-26537019 GGAAATGAGTGATCTGGAACAGG - Intergenic
1005848977 6:29804521-29804543 GCAAAGACATGACCTGAAACTGG + Intergenic
1005869049 6:29959741-29959763 GCAAAAAAATGATCTGAAACTGG + Intergenic
1007214966 6:40229666-40229688 GCAAAGGAATGACCTAAATGTGG - Intergenic
1007361472 6:41359814-41359836 GCAAAGAAATGACATAAAACTGG + Intergenic
1007673744 6:43577985-43578007 GCAGAGGAATCACTTGAAACCGG + Intronic
1007882646 6:45184830-45184852 GCAAAGCAATGATCATAAAAAGG + Intronic
1007975349 6:46095407-46095429 GCAAAGAAATGACCTGAAATTGG - Intergenic
1008104733 6:47429199-47429221 GCAAATAAATGACCTGAAACTGG - Intergenic
1008998823 6:57689437-57689459 GCAAAGAAATGACCTGAAACTGG - Intergenic
1009187309 6:60588816-60588838 GCAGAGAAATGACCTGAAACTGG - Intergenic
1009579067 6:65508578-65508600 GCAAGGGAATGATGTGAACCTGG + Intronic
1009791096 6:68402538-68402560 ACAACGAAATAATCTGAAACTGG - Intergenic
1009791273 6:68404134-68404156 ACAAAGAAATAATCTGAAACTGG - Intergenic
1010630557 6:78192437-78192459 ACAAAAGAGTGATATGAAACTGG - Intergenic
1010678017 6:78767387-78767409 GCAAAAAGAAGATCTGAAACTGG + Intergenic
1011028648 6:82897216-82897238 TCAAAGTTATGATCTGAAACAGG + Intronic
1011348806 6:86400272-86400294 GCAAATAAATGATCTAAAACTGG - Intergenic
1012210152 6:96509483-96509505 GCAAAGAGATGGTCTGAAATTGG + Intergenic
1013480460 6:110548768-110548790 GCAAGAGAATCATTTGAAACTGG - Intergenic
1014040840 6:116823188-116823210 GCAAGGAAATGATGTAAAACTGG - Intronic
1014247788 6:119085216-119085238 GAAAAAAAATTATCTGAAACTGG - Intronic
1015752655 6:136575934-136575956 GCAAAAGAATGAGGAGAAACAGG - Intronic
1016169727 6:140996885-140996907 GCCTGGGAATGAACTGAAACTGG - Intergenic
1016512892 6:144863546-144863568 ACAAAGAGATGATCTGAAATTGG + Intergenic
1016589433 6:145728647-145728669 GCAAAGAGATTATCTGAAACTGG + Intronic
1017859148 6:158379104-158379126 GCATAGGTGTGATGTGAAACTGG + Intronic
1018122962 6:160655433-160655455 ACAAAAGAAGGCTCTGAAACAGG - Intronic
1018155632 6:160983048-160983070 GCAAAGAGACGATCTGAAACTGG + Intergenic
1018564335 6:165136076-165136098 GCAAATAAATGGCCTGAAACTGG + Intergenic
1018666841 6:166146565-166146587 GCAAAAGAATCACTTGAAACTGG - Intergenic
1019155538 6:170036416-170036438 ACAAAGAAACGATCTGAAATTGG - Intergenic
1021222773 7:17992504-17992526 GCAGGGGAATGATTTGAACCCGG - Intergenic
1021326442 7:19275132-19275154 GCAAAGGAATCAACTAAAAAAGG - Intergenic
1021519611 7:21526387-21526409 ACAAAGAGATGGTCTGAAACTGG + Intergenic
1021951861 7:25782885-25782907 GAAAAGGGATCATCTGAGACAGG + Intergenic
1022703523 7:32782800-32782822 GCAAAGAAATGACCTGAAACTGG - Intergenic
1022712637 7:32865879-32865901 GCAATGTAATGACCTGAAACTGG - Intergenic
1022907763 7:34872926-34872948 GCAAAGAAATGACCTGAAACTGG - Intronic
1022910359 7:34895115-34895137 GCAAAGAAATGACCTGAAACTGG + Intergenic
1023048027 7:36228431-36228453 GCAAGAGAATTATCTGAACCTGG + Intronic
1024084048 7:45878918-45878940 GCAAAGAGATTATCTGAAGCTGG - Intergenic
1024729115 7:52235069-52235091 GCAAAGAGATGATCTGAAACTGG + Intergenic
1025823122 7:64989976-64989998 GCAGAAGAATCATCTGAACCTGG + Exonic
1027666413 7:81046810-81046832 ACAAAGAAATGATCTGAAACTGG + Intergenic
1027729417 7:81851139-81851161 GCAAAGGAAACATCTGGAAAAGG + Intergenic
1027834776 7:83226975-83226997 TCAATGGGATGATCTGAATCTGG + Intergenic
1027959088 7:84920314-84920336 GCAAAGAGATGATCTGAAACTGG - Intergenic
1028094333 7:86741567-86741589 GCAAATTAGTGAGCTGAAACTGG - Intronic
1028525373 7:91778989-91779011 GCAAATGTATGATGAGAAACAGG + Intronic
1029292918 7:99516394-99516416 GCAGAGAAGGGATCTGAAACCGG - Intronic
1030305638 7:108016375-108016397 GCACAGGAATCATTTGAACCTGG - Intergenic
1031182114 7:118432481-118432503 GCAAAGAGATAATCTGAAACTGG + Intergenic
1031261949 7:119532704-119532726 GCAAAGAAATGATCTAAAGTTGG + Intergenic
1031478092 7:122247370-122247392 ACAAAGAGATGATCTGAAATTGG + Intergenic
1031583533 7:123505919-123505941 GCAAGGAGATGATCTGAAACTGG - Intronic
1031611450 7:123832591-123832613 GCAGAAGAATGATGTGAACCCGG - Intronic
1031618317 7:123906156-123906178 GCAAAGAAATAACCTGAAACTGG - Intergenic
1031991783 7:128203277-128203299 CCTGAGGACTGATCTGAAACAGG + Intergenic
1032442789 7:131954960-131954982 GCAAAGAAATGATGGGGAACAGG - Intergenic
1033063522 7:138129988-138130010 GCAAAGAAATGATCTGAAACTGG - Intergenic
1033409225 7:141101817-141101839 GCAAAGGAATAATCGGAACATGG + Intronic
1033918204 7:146354506-146354528 GCAAAAGAATCACCTGAACCTGG - Intronic
1034145518 7:148867757-148867779 GCAAATAAATGACCTGAAACTGG - Intronic
1034153782 7:148937699-148937721 GCAAAAGAATGGTGTGAACCCGG + Intergenic
1034160511 7:148990933-148990955 GCAGAAGAATGATGTGAACCTGG + Intergenic
1035128498 7:156629177-156629199 GGAAAGAAATAACCTGAAACTGG + Intergenic
1035237003 7:157504095-157504117 GCAAAAGAATCATTTGAACCTGG - Intergenic
1037411609 8:18604454-18604476 GCAAAGAAATGACCTAAAACTGG + Intronic
1038032738 8:23658425-23658447 GCAATGGAATAATTTGAAAATGG - Intergenic
1038070172 8:24005066-24005088 GGTCAGGAATGATCTGAAGCAGG + Intergenic
1038684258 8:29702047-29702069 GCAAAGAGATAATCTAAAACTGG + Intergenic
1038869856 8:31482032-31482054 ACATAGGAAAAATCTGAAACTGG - Intergenic
1039979697 8:42398250-42398272 GTAATGGAAAGATCTGAAACTGG + Intronic
1040097973 8:43466612-43466634 GTAAAGAAATGATCTGAAACTGG - Intergenic
1040721504 8:50329889-50329911 GGAAAGAGATGATCTGAAATTGG - Intronic
1041215096 8:55592621-55592643 GCAGAAGAATGATGTGAACCTGG - Intergenic
1041392466 8:57359260-57359282 GTAAAGAGATAATCTGAAACTGG + Intergenic
1041682148 8:60604784-60604806 GCAGAGAAGTGACCTGAAACTGG + Intronic
1043085488 8:75826790-75826812 GCAAAGAAGTGATCTAAAGCTGG + Intergenic
1043811930 8:84752345-84752367 GCAAAGAAGTTACCTGAAACTGG + Intronic
1043955280 8:86352316-86352338 GCACAAGAATCATTTGAAACTGG - Intronic
1045174414 8:99706335-99706357 AGAAAGTAATGATCTTAAACAGG - Intronic
1045561754 8:103271000-103271022 GCAAAGAGATGATCTACAACTGG + Intergenic
1046034157 8:108821301-108821323 GCAAATAAATTATCTAAAACTGG + Intergenic
1046735092 8:117768334-117768356 GAAAAGAGATGATCTAAAACTGG + Intergenic
1046826250 8:118695104-118695126 ACAAAGAAATGACCTGAAACTGG - Intergenic
1046878248 8:119279111-119279133 GCAAAGAAATGACCTGAAACTGG - Intergenic
1047937805 8:129799103-129799125 GCAAATAGATGATCTGAAACTGG - Intergenic
1048213366 8:132475667-132475689 ACAAAGGGATGGTCTGAAATTGG + Intronic
1048517586 8:135124765-135124787 GCAAGAGAATGATGTGAACCCGG - Intergenic
1048749489 8:137655722-137655744 GTAAATGAATGATATAAAACCGG + Intergenic
1049589356 8:143449337-143449359 GCAAAGAAATGACCTCAAGCTGG - Intronic
1050109600 9:2200816-2200838 ACAAAGAGATGATCTGAAACTGG - Intergenic
1050288578 9:4130169-4130191 GCAAAGAAATGAGCTGAAACTGG + Intronic
1050415101 9:5408526-5408548 GCAAAGAAATGACCTAAAACTGG + Intronic
1050674603 9:8037344-8037366 GCAAATTAAAGAACTGAAACTGG - Intergenic
1050996928 9:12232269-12232291 ACAAATAAATAATCTGAAACTGG - Intergenic
1051582802 9:18695452-18695474 GCAAAGACATAACCTGAAACTGG - Intronic
1051925147 9:22316562-22316584 ACAAAGAGATGATCTGAAACTGG + Intergenic
1052004475 9:23329936-23329958 GCAAAGAAATGACATGAAATTGG + Intergenic
1052168114 9:25358186-25358208 ACAAAGAGATTATCTGAAACTGG - Intergenic
1052173880 9:25433287-25433309 ACAAAGAGATTATCTGAAACTGG - Intergenic
1052179442 9:25506042-25506064 GCAAAGAGATTATCTGAAACTGG - Intergenic
1052208370 9:25870613-25870635 GCAAGGAAATTATCTGAAACTGG - Intergenic
1052362851 9:27578262-27578284 GCACAGAAATGACCTGAAATTGG - Intergenic
1052522154 9:29562456-29562478 ACAAAGAAATGGTTTGAAACTGG + Intergenic
1052702252 9:31951163-31951185 GCAAATAAATGGCCTGAAACTGG - Intergenic
1053084132 9:35203733-35203755 GCAAGGAAATGACCTGAAACTGG + Intronic
1053616459 9:39771025-39771047 ACAAAGAAATGACCTGCAACTGG - Intergenic
1053877754 9:42561274-42561296 ACAAAGAGATGATCTGAAATTGG + Intergenic
1053897988 9:42764255-42764277 ACAAAGAAATGACCTGCAACTGG + Intergenic
1054233940 9:62540420-62540442 ACAAAGAGATGATCTGAAATTGG - Intergenic
1054237059 9:62571364-62571386 ACAAAGAAATGACCTGCAACTGG + Intergenic
1054551197 9:66605875-66605897 ACAAAGAAATGACCTGCAACTGG + Intergenic
1054848221 9:69819916-69819938 GTAGGGGAAGGATCTGAAACTGG + Intergenic
1055335219 9:75226785-75226807 GCAAAGAAATGACCTGAAGCTGG - Intergenic
1055615373 9:78066671-78066693 TCAAAGAGATTATCTGAAACTGG - Intergenic
1056376882 9:86023388-86023410 GCAAAGGAATGGTAGGAAATAGG + Intergenic
1056429013 9:86508123-86508145 CCAAAGGGATGAGCTGCAACTGG - Intergenic
1056466188 9:86857714-86857736 CCAAAAGATTGATCAGAAACTGG + Intergenic
1056466394 9:86859933-86859955 CCAAAAGATTGATCAGAAACTGG + Intergenic
1056527390 9:87455882-87455904 GCAAAGAAATGGCCTGAAATTGG - Intergenic
1056687265 9:88776975-88776997 GCAAAGGAATGTTTGAAAACTGG + Intergenic
1057983175 9:99682373-99682395 GCAAAGAGATTATCTGAAACTGG - Intergenic
1058476724 9:105342293-105342315 ACAAAGGGATGATCTGTATCTGG - Intronic
1059033124 9:110722434-110722456 GCAGAGGAATCACTTGAAACTGG + Intronic
1059604895 9:115824131-115824153 GCAAAGAGATTATCTGAAACTGG + Intergenic
1059617637 9:115967941-115967963 GCAAAGAAATGACCTAAAACTGG - Intergenic
1059703250 9:116796104-116796126 GCCAAGGACAGATATGAAACAGG + Intronic
1060019513 9:120117058-120117080 GCAAATAAATGATCTGAAAATGG + Intergenic
1061283790 9:129611167-129611189 GCAAAGGAATGGGCTGCAAACGG - Intronic
1185639872 X:1583747-1583769 GCAGAGGAATCGTCTGAACCCGG - Intergenic
1185950012 X:4422406-4422428 GCAAAAGAATGGTATGAACCCGG - Intergenic
1186488640 X:9953601-9953623 GCAAAGAGATGATCTGAAACAGG - Intergenic
1186932611 X:14411410-14411432 GTAAAGGAATGATTTGAACTGGG + Intergenic
1187104272 X:16223839-16223861 GCAAAGGAATGACCTAAAGGTGG - Intergenic
1187104772 X:16230137-16230159 GTAAAGGAGTGATTTGAAAGTGG - Intergenic
1187180605 X:16939895-16939917 GCAAAGAAATGACCTGAAACTGG - Intergenic
1187603688 X:20861027-20861049 ACAAAGAGATTATCTGAAACTGG + Intergenic
1187706051 X:22010395-22010417 GCAAACTAATGATCTGACAAGGG + Intergenic
1187843098 X:23509211-23509233 GCAAAGAAATGACCTGAAACTGG + Intergenic
1188387086 X:29574743-29574765 GCAAAGGGATGATCTGAAACTGG - Intronic
1188657551 X:32716988-32717010 GCAAAGAGATTATCTGAAACTGG + Intronic
1189180524 X:39000333-39000355 GCAGAGAAAGAATCTGAAACTGG + Intergenic
1189431484 X:40950983-40951005 GCCAAGAAATGACCTGAAACTGG - Intergenic
1189594447 X:42549008-42549030 GCAAAGAAATGATCTAAACTTGG - Intergenic
1189858935 X:45252408-45252430 GCAAAGGAATGATATAAAGCTGG - Intergenic
1190506694 X:51133548-51133570 GCAAAGATAGGATCTGGAACTGG + Intergenic
1190556052 X:51636988-51637010 ACAAAGGAATGATAAGAGACAGG - Intergenic
1190772388 X:53526352-53526374 ACAAAGAGATTATCTGAAACTGG + Intergenic
1190982165 X:55465834-55465856 GCAGAAGTAGGATCTGAAACTGG + Intergenic
1190986533 X:55507348-55507370 GCAGAAGTAGGATCTGAAACTGG - Intergenic
1191131450 X:57016121-57016143 GCAAACTATTGATCTGACACAGG - Intergenic
1191760829 X:64646718-64646740 GCAAATAAATGATGTAAAACTGG + Intergenic
1191873273 X:65768679-65768701 GCAAAGAGATGATCTGAAACTGG + Intergenic
1191877661 X:65812640-65812662 GCAAAGAGATGATCTGAAATTGG + Intergenic
1192066555 X:67891235-67891257 GCAAAGAGATAATCTGAACCTGG + Intergenic
1192936922 X:75870204-75870226 GCAAAGAAATGACCTAAACCTGG + Intergenic
1193143591 X:78054871-78054893 CCAAAGAGATAATCTGAAACTGG - Intergenic
1193226115 X:78986083-78986105 GCAAACAGATGATTTGAAACTGG - Intergenic
1193332876 X:80255638-80255660 GCAAAAAGATGATCTGAAACTGG + Intergenic
1193406368 X:81106968-81106990 GCAAATAAATGACCTGAAACTGG + Intergenic
1193412642 X:81183105-81183127 GCAAAGAAATGAACTGAAACTGG + Intronic
1193489756 X:82134479-82134501 GCAAACAGATTATCTGAAACTGG - Intergenic
1193491984 X:82161810-82161832 GCAAAGAGATATTCTGAAACTGG + Intergenic
1193861331 X:86672185-86672207 GCAAAGACACAATCTGAAACTGG + Intronic
1193871665 X:86805637-86805659 GCAAACAAATGACCTGATACTGG - Intronic
1194003296 X:88458384-88458406 GCAAGGGAATGGTGTGAACCCGG + Intergenic
1194043400 X:88971050-88971072 ACAAAGAGATGATCTGAAATTGG - Intergenic
1194064120 X:89241154-89241176 ACAAAGAAATGACCTGAAACTGG + Intergenic
1194084658 X:89510601-89510623 GCAAAGAAATGTTCTGAAACTGG - Intergenic
1194206359 X:91015875-91015897 GCAAAGCAATGATGAAAAACTGG - Intergenic
1194360400 X:92942521-92942543 GCAATGAAATGATCTGAAACTGG - Intergenic
1194418041 X:93637571-93637593 GCAAAGAAATGACCTGAAACTGG + Intergenic
1194459079 X:94143348-94143370 GCAAAGAAATGACCTGAAAGTGG - Intergenic
1194590736 X:95797338-95797360 GCAAAGAAATGATCTAAAACTGG + Intergenic
1194603750 X:95956785-95956807 AAACAGAAATGATCTGAAACTGG + Intergenic
1194881244 X:99254166-99254188 GCAAAGAGATGATCTGAAACTGG - Intergenic
1194895211 X:99432113-99432135 GCAAAGAAATTACCTGAAACTGG + Intergenic
1194910156 X:99631436-99631458 GAACAGAGATGATCTGAAACTGG - Intergenic
1194943607 X:100041905-100041927 AAAAAGAAATGACCTGAAACTGG - Intergenic
1194944118 X:100048150-100048172 ACAAAGAAACGACCTGAAACTGG + Intergenic
1195715928 X:107818836-107818858 GCAAATAAATGACCTGGAACTGG + Intergenic
1196168981 X:112566162-112566184 ACAAATAAATGACCTGAAACTGG - Intergenic
1196384767 X:115137679-115137701 GTTAAGGAATGATCAGAAACTGG + Intronic
1196527605 X:116744852-116744874 GCAGAAGAATGATGTGAACCCGG + Intergenic
1196601379 X:117605144-117605166 GCAAAGAAATGCTCTGAAACTGG + Intergenic
1196601955 X:117611737-117611759 GCAGAGTAACGTTCTGAAACTGG + Intergenic
1196751545 X:119122157-119122179 GCAAAAGAATCACTTGAAACTGG - Intronic
1197208230 X:123808385-123808407 GCAAATGAATGCCCTGAAAAGGG - Intergenic
1197347846 X:125345977-125345999 GCAAAGGAATCATCTAAAGTTGG - Intergenic
1197385371 X:125795303-125795325 GTTAAGAAATGATCTGAAACTGG + Intergenic
1197510940 X:127368404-127368426 GCAAAGAAATGATGTAAAACTGG - Intergenic
1197692538 X:129518482-129518504 GCAAAGCAAGGTTCTTAAACTGG + Intronic
1197758739 X:130013694-130013716 GCCAAGGGAGGAGCTGAAACTGG - Exonic
1198696790 X:139349425-139349447 GCAAAGGAATCATCTGACAAAGG - Intergenic
1199196056 X:145032360-145032382 TCAAAGAGATAATCTGAAACTGG + Intergenic
1199223547 X:145344514-145344536 GCAAAGAAATGACCGGAAACTGG - Intergenic
1199250712 X:145659053-145659075 ACAGAGAAATGACCTGAAACTGG + Intergenic
1199372498 X:147067298-147067320 GAAAATTAATGATATGAAACAGG - Intergenic
1199987178 X:152961130-152961152 TCAAGGGAATGACCTGGAACTGG - Intronic
1200106469 X:153716070-153716092 GCAAAAGAATCATTTGAACCCGG + Intronic
1200357032 X:155562649-155562671 ACAAAGAAATGGTCTGAAATTGG - Intronic
1200437304 Y:3166487-3166509 GCAAAGAAATGTTCTGAAACTGG - Intergenic
1200552111 Y:4590696-4590718 GCAAAGCAATGATGAAAAACTGG - Intergenic
1200718294 Y:6575253-6575275 ACAAAGAAATGACCTGAAACTGG + Intergenic
1200829233 Y:7674326-7674348 GCAGGGGAATCATTTGAAACTGG - Intergenic
1201180367 Y:11336897-11336919 GAAAAGCAATGAACAGAAACAGG + Intergenic
1201947799 Y:19530830-19530852 GCAAAGAAATGACCTAAAATTGG + Intergenic
1202164501 Y:21971985-21972007 GCAAGGGAATCACCTGAACCTGG - Intergenic
1202226855 Y:22614387-22614409 GCAAGGGAATCACCTGAACCTGG + Intergenic
1202316265 Y:23581267-23581289 GCAAGGGAATCACCTGAACCTGG - Intergenic
1202554499 Y:26088799-26088821 GCAAGGGAATCACCTGAACCTGG + Intergenic