ID: 1087712180

View in Genome Browser
Species Human (GRCh38)
Location 11:101567047-101567069
Sequence GCTGAAGTCTGGCTCGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 278}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087712164_1087712180 23 Left 1087712164 11:101567001-101567023 CCTGGAACGCCAGTGAGACAGAA 0: 32
1: 315
2: 502
3: 571
4: 486
Right 1087712180 11:101567047-101567069 GCTGAAGTCTGGCTCGGGGCGGG 0: 1
1: 0
2: 0
3: 31
4: 278
1087712173_1087712180 -10 Left 1087712173 11:101567034-101567056 CCCTGGAAAGGGGGCTGAAGTCT 0: 1
1: 32
2: 585
3: 592
4: 494
Right 1087712180 11:101567047-101567069 GCTGAAGTCTGGCTCGGGGCGGG 0: 1
1: 0
2: 0
3: 31
4: 278
1087712172_1087712180 -9 Left 1087712172 11:101567033-101567055 CCCCTGGAAAGGGGGCTGAAGTC 0: 20
1: 506
2: 561
3: 326
4: 369
Right 1087712180 11:101567047-101567069 GCTGAAGTCTGGCTCGGGGCGGG 0: 1
1: 0
2: 0
3: 31
4: 278
1087712165_1087712180 14 Left 1087712165 11:101567010-101567032 CCAGTGAGACAGAACCATTCACT 0: 129
1: 283
2: 449
3: 437
4: 514
Right 1087712180 11:101567047-101567069 GCTGAAGTCTGGCTCGGGGCGGG 0: 1
1: 0
2: 0
3: 31
4: 278
1087712169_1087712180 0 Left 1087712169 11:101567024-101567046 CCATTCACTCCCCTGGAAAGGGG 0: 334
1: 445
2: 319
3: 176
4: 277
Right 1087712180 11:101567047-101567069 GCTGAAGTCTGGCTCGGGGCGGG 0: 1
1: 0
2: 0
3: 31
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087712180 Original CRISPR GCTGAAGTCTGGCTCGGGGC GGG Intronic
900265043 1:1753182-1753204 GCTCAAGCCTGCCTCGGGGAGGG - Intronic
900372168 1:2336923-2336945 GCTGAAGTGTGGCTCTGGCCAGG + Intronic
900487241 1:2928985-2929007 GCTGCAGTGTGGCTCAGAGCAGG + Intergenic
900517825 1:3091525-3091547 GGAGAAGTGTGGCACGGGGCAGG - Intronic
900556758 1:3284556-3284578 GCTGAACTCTGGCTGCTGGCAGG - Intronic
901421947 1:9157130-9157152 GGTGAAGTAGGGCTCGGGGAGGG + Intergenic
901440537 1:9275370-9275392 GCTGACTGCTGGCTCAGGGCTGG + Intergenic
901458224 1:9376203-9376225 GCTGAACTCTGGCGGGAGGCAGG - Intergenic
901570925 1:10159907-10159929 GCTAAAGCCTGGCACGAGGCAGG + Intronic
902138854 1:14334668-14334690 GCTGAAGGCTGGGCTGGGGCTGG + Intergenic
902503385 1:16924869-16924891 GCTGGATGCTGGCTCGAGGCTGG + Intronic
903191789 1:21660628-21660650 GCTCAAGACTGAGTCGGGGCTGG - Intronic
903323630 1:22556824-22556846 GCTGCAGTGTGGCTAGCGGCTGG + Intergenic
904209016 1:28873562-28873584 GCTGAAGTCCAGCTCAGGGCAGG + Intergenic
905002882 1:34686970-34686992 GCTGCAGTCTGTCTCTGTGCTGG - Intergenic
905605555 1:39296102-39296124 GCTGCAGACAGGCTGGGGGCTGG + Intronic
906551152 1:46667670-46667692 GCTGAGGCCTGGCTCAGAGCTGG - Intronic
906693656 1:47809786-47809808 GCTGTGGACTGGCTCTGGGCTGG + Intronic
907304243 1:53505014-53505036 GCTGCCCTCTGGCTCCGGGCTGG - Intergenic
908037724 1:60073868-60073890 GCTGAAGGCTGTTTCTGGGCGGG + Intergenic
908419508 1:63946150-63946172 GCTGGTGTGTGGCTCTGGGCAGG + Intronic
911700773 1:100949727-100949749 GCTGCAGCCTGGCTGGGGGAGGG - Intronic
913173735 1:116255484-116255506 GCTGAAGTGTGGCTGGGGGGTGG - Intergenic
914004088 1:143717594-143717616 GCTCAGGTCCGGGTCGGGGCCGG - Intergenic
914095312 1:144539951-144539973 GCTCAGGTCCGGGTCGGGGCCGG - Intergenic
914303214 1:146393945-146393967 GCTCAGGTCCGGGTCGGGGCCGG + Intergenic
915082462 1:153361365-153361387 GGTGAAGACAGGCTTGGGGCTGG - Intergenic
919075570 1:192808924-192808946 GCTGCAGACTGGCACGGGGATGG - Intergenic
919748701 1:201023745-201023767 GCTCGGGGCTGGCTCGGGGCGGG - Intergenic
919837509 1:201585145-201585167 CCTGAAGTCAGGCACTGGGCTGG + Intergenic
921841763 1:219836159-219836181 TCTGACCTCTGGCTCTGGGCAGG - Intronic
922801190 1:228365443-228365465 GGTGCAGCCTGGCCCGGGGCAGG + Exonic
1063171848 10:3516373-3516395 GCTGTGGGCTGGCTGGGGGCCGG - Intergenic
1063460813 10:6213975-6213997 GGTGAAATCTGAGTCGGGGCAGG - Intronic
1067497920 10:46775568-46775590 GATGAAGTCAGGCTTGGGGCAGG + Intergenic
1067596728 10:47564846-47564868 GATGAAGTCAGGCTTGGGGCAGG - Intergenic
1068253045 10:54469531-54469553 GGTGAAGTCTTGCTGGGGACAGG + Intronic
1070140069 10:73732408-73732430 GATGAAGTCAGGCTTGGGGCAGG - Intergenic
1072969881 10:100008399-100008421 GCTCAAGTCTGGCTTGGGAACGG - Intronic
1073694510 10:105849760-105849782 GCTGGAGCCTGGCTAGGGGCAGG + Intergenic
1074873631 10:117597083-117597105 GCTGAACTGTGGCCGGGGGCTGG - Intergenic
1074942607 10:118249648-118249670 GCTGAAGGCTGGCTGGGGCTTGG - Intergenic
1075094210 10:119460592-119460614 GCTGGAGTGTGGCTCCAGGCAGG - Intergenic
1075788018 10:125063096-125063118 GCTGAGGTCCAGCTCGAGGCTGG - Intronic
1076250290 10:128979507-128979529 GCAGAAGGTTGGCTGGGGGCTGG - Intergenic
1076260084 10:129058430-129058452 GCTGCAGTCTAGCGCTGGGCAGG + Intergenic
1076942063 10:133616561-133616583 GCTGAAGTCGTCCCCGGGGCAGG + Intergenic
1077250374 11:1558200-1558222 GATGAAGTCAGGCTTGGGGCAGG + Exonic
1077445130 11:2587279-2587301 GCTCAAGGCTGGCTCAGGGCTGG + Intronic
1078036123 11:7806678-7806700 GCTGAAGTTTTGCTGGGGACTGG - Intergenic
1078426012 11:11252021-11252043 GCTGCAGTCTGGCTATGGTCGGG + Intergenic
1080779775 11:35419448-35419470 GCTGCGCTCTGGCTCGGCGCCGG + Intronic
1083300813 11:61738839-61738861 GCTGAGGGCTCGCCCGGGGCAGG - Intronic
1083428487 11:62601715-62601737 GCTGGAGCCTGGCTCTGGCCTGG - Exonic
1084858731 11:72004732-72004754 GCTGCATGCTGGCTCGGCGCAGG + Exonic
1085088323 11:73688294-73688316 GCTGAACTCTGGATCTAGGCTGG + Intronic
1086347927 11:85916636-85916658 TCTGAAGGCTTGATCGGGGCAGG + Intronic
1086612862 11:88778169-88778191 GCTGTAGCCTGGCTGGGGGAGGG - Intronic
1086995725 11:93353575-93353597 GCAGAAGTTTGCTTCGGGGCGGG - Intronic
1087311159 11:96545411-96545433 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
1087712180 11:101567047-101567069 GCTGAAGTCTGGCTCGGGGCGGG + Intronic
1088004637 11:104926050-104926072 GCGGAAGCCTGGCTGGGGGAGGG - Intergenic
1089567433 11:119379086-119379108 GCTGGAGCCTGACTCTGGGCTGG + Intronic
1089588078 11:119522591-119522613 GCTGGAGCCTGGCTCGGTGGGGG - Intergenic
1089616209 11:119696340-119696362 GCTGAAGTCTAGCTGGGGGTAGG - Intronic
1089897152 11:121942104-121942126 TCTGAAGTCTTGATAGGGGCTGG - Intergenic
1090014285 11:123072061-123072083 CCAGAAGTCTAGCTCTGGGCTGG - Exonic
1090377854 11:126304016-126304038 GCTGGACTCGGGCTAGGGGCGGG + Exonic
1092601311 12:10068706-10068728 GCTGCAGTCTAGCTCAGGGATGG - Intergenic
1094135395 12:27120017-27120039 GCTGTAGCCTGGCTGGGGGAGGG - Intergenic
1094759980 12:33521143-33521165 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
1094807617 12:34107831-34107853 GCTGCCGCCTGGCTAGGGGCAGG + Intergenic
1096477542 12:51917608-51917630 AATGAAGTCTGGCATGGGGCTGG - Intronic
1100658353 12:96671000-96671022 GATGAAGTCTTGCTCCAGGCTGG + Intronic
1102459745 12:113093223-113093245 GGTGAGGTCTGGCCCAGGGCGGG + Exonic
1102514873 12:113439736-113439758 GGGGAAGGCTGGCTCCGGGCAGG + Intergenic
1103906147 12:124328119-124328141 GCTGGGGGCTGGCTGGGGGCTGG + Intronic
1104206332 12:126642434-126642456 GCTGCAGCCTGGCACGGGGAGGG - Intergenic
1104643780 12:130483491-130483513 GCTGCAGTCCTGCTGGGGGCTGG + Intronic
1104645020 12:130491086-130491108 GCTGATGTCTGGAGCTGGGCTGG - Intronic
1104709832 12:130977718-130977740 GCTGAAGGCTGACTCGGGCTGGG - Intronic
1105458821 13:20565669-20565691 GCTGAAGGCAGTCTGGGGGCAGG + Intergenic
1105896355 13:24719901-24719923 GCTGAGCTCAGGCTGGGGGCGGG + Intergenic
1107991118 13:45819949-45819971 GCTGCAGTCTGCCTCGGAGATGG + Intronic
1108717799 13:53099188-53099210 GCTGAACTCTGACTCGTGGAGGG - Intergenic
1112412044 13:99173033-99173055 GTTGCAGCCTGGCTCGGGGAGGG - Intergenic
1113741849 13:112716598-112716620 GCCAGAGCCTGGCTCGGGGCTGG + Intronic
1113777042 13:112953775-112953797 GCTGGGGTCTGGCTGGGGTCAGG - Intronic
1113879991 13:113619659-113619681 TCTGAAGTGCTGCTCGGGGCCGG + Intronic
1114981297 14:28168388-28168410 GCTGCAGCCTGGCTGGGGGATGG + Intergenic
1119730562 14:76948411-76948433 GCTGAGCACTGGCTCGGTGCCGG - Intergenic
1122637324 14:103136172-103136194 GCTGAGGTCTGGGCAGGGGCAGG + Exonic
1122779103 14:104136216-104136238 GCTGGTGTCTGGCTCGCCGCCGG + Intergenic
1122857998 14:104569090-104569112 GCTGAGGTGTGGCTAGGGGCAGG - Intronic
1122905997 14:104801770-104801792 GTTGAAGTCTGGCCCAAGGCAGG + Exonic
1123063668 14:105605746-105605768 GCTGGGGCCTGGCTGGGGGCTGG + Intergenic
1123945922 15:25238874-25238896 GCTGAACTCTGGCTGGTGCCCGG + Intergenic
1125492481 15:40158586-40158608 GCTGATGTCTGGCTCCAGGGAGG + Intergenic
1125760622 15:42093534-42093556 GCTGATGTCTGACTCGTGGGTGG + Intronic
1125794455 15:42394170-42394192 GCTGAGGGCTGGGACGGGGCTGG - Intronic
1126849123 15:52786960-52786982 CCTGAAGCCTGGCTCTGGGGTGG + Intronic
1127193733 15:56561817-56561839 GCTGAAGCCTGGCCGGGGGAGGG + Intergenic
1129844911 15:78763780-78763802 GCAGAGGCCTGGCTCCGGGCAGG + Exonic
1130256914 15:82330060-82330082 GCAGAGGTCTGGCTCTGGGCAGG - Intergenic
1130403467 15:83578291-83578313 GCTGAAGCCAGGCTGAGGGCAGG - Intronic
1130598034 15:85259928-85259950 GCAGAGGTCTGGCTCTGGGCAGG + Intergenic
1130838406 15:87674254-87674276 GCTGAAGTAGGACTCAGGGCTGG - Intergenic
1132608423 16:803106-803128 GCTGGAGTCAGCCTCGGGTCTGG + Intergenic
1132654960 16:1037879-1037901 CCTGAAGGCTGGCCTGGGGCTGG - Intergenic
1132695944 16:1202066-1202088 GCAGGCGCCTGGCTCGGGGCCGG - Exonic
1132788311 16:1670532-1670554 GCACAAGTCTGGATTGGGGCCGG + Intronic
1133130065 16:3671480-3671502 GCTGGAGTCTGGATAGGGGGAGG - Intronic
1134133126 16:11663267-11663289 GCTGAGGGCAGGCTGGGGGCAGG + Intergenic
1134294571 16:12934130-12934152 GCTGAAGTCTGGCAAGGGAGGGG + Intronic
1135049316 16:19179689-19179711 GCTGAACCCTGGCTGGGTGCTGG - Intronic
1136581604 16:31154804-31154826 TTAGAAGTCTGGCACGGGGCCGG + Intergenic
1138651508 16:58463884-58463906 GCTGGGGTCGTGCTCGGGGCTGG - Intronic
1141487528 16:84350810-84350832 GCAGAAGGCTGCCTCCGGGCCGG + Intergenic
1142204576 16:88776743-88776765 GCTGGACCCTGGCTCGGGGCGGG + Intronic
1144642163 17:16943625-16943647 GCTGATGTCCTGCTGGGGGCAGG - Intronic
1144835917 17:18156692-18156714 GCTGAAGTCTTCCTCGGGCCTGG - Intronic
1147160211 17:38565092-38565114 GCTGATATCTGGCTGGGGGTGGG + Intronic
1147324474 17:39663708-39663730 GCTGAAGCCTGGCAGGGGGCGGG - Intergenic
1147661885 17:42121195-42121217 GCTGAAGCCGGGCTGGGTGCAGG + Exonic
1148087968 17:45006128-45006150 GCTGAGCTCTGGCTCGGGGTGGG + Intergenic
1148192566 17:45689791-45689813 GCTGCAGCGTGGCTCTGGGCTGG - Intergenic
1149429732 17:56588314-56588336 GCTGAAGTCTGGGTCTAGGATGG - Intergenic
1149556362 17:57576151-57576173 GCTGAACACTGGCTCTGTGCTGG + Intronic
1150025851 17:61673453-61673475 GCTGCAGCCTGGCTAGGGGAGGG + Intergenic
1150288188 17:63965906-63965928 GCTGTGGCTTGGCTCGGGGCAGG + Intronic
1151533890 17:74726283-74726305 GCTGAACCTTGGCTCGGGGTGGG - Intronic
1151956794 17:77384141-77384163 GCGGGAGGCTGGCTGGGGGCTGG + Intronic
1152542228 17:80982137-80982159 GCTGACGCCTGGCTTGGGCCAGG - Intergenic
1152929344 17:83101933-83101955 GCTGGACTCAGGCTCGGGGGAGG - Intergenic
1155437826 18:25831572-25831594 GCTGAAGGCTGGCTTGGAGGAGG - Intergenic
1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG + Intronic
1157228534 18:45891061-45891083 GCTGAAGACTGGGTTTGGGCAGG - Intronic
1158235373 18:55306914-55306936 GTTGAAGACTGGGTGGGGGCAGG + Intronic
1159051213 18:63422617-63422639 GCGGAAGTCGGGCTCGGCGCAGG + Intergenic
1159940131 18:74400547-74400569 GGTGCACTCAGGCTCGGGGCAGG - Intergenic
1160209053 18:76860933-76860955 GCTGAAGTCTGGCGTGAAGCTGG + Intronic
1160867831 19:1263490-1263512 GCTGGAGTCTGGGTGGGGGATGG + Intronic
1161272421 19:3397436-3397458 GCTGCAGCCAGGCTGGGGGCTGG + Intronic
1162932214 19:13962877-13962899 GACCAAGTCCGGCTCGGGGCGGG + Intronic
1162971425 19:14183403-14183425 GCTGAGGTCTGGGGCGGGGCAGG + Intronic
1163425799 19:17240465-17240487 GCTGCAGTCTGGCCCTAGGCTGG - Intronic
1165188116 19:34039479-34039501 GCAGAAGGATGGCTGGGGGCTGG - Intergenic
1165273720 19:34731768-34731790 GCCTGAGGCTGGCTCGGGGCTGG - Intergenic
1165742508 19:38212151-38212173 GCTGAAGTCAGGCCCGGGTCCGG + Intronic
1166231495 19:41427668-41427690 GCTGAAGGCTGGGCCTGGGCTGG + Intronic
1166333298 19:42090922-42090944 GCTGAGGTCTGGCTCGCGACTGG + Exonic
1167537771 19:50065871-50065893 GCTGAGGCCTGGCCAGGGGCAGG + Intergenic
1167587123 19:50381501-50381523 GCTGGAGCCTGGCACGTGGCAGG + Intronic
925836551 2:7952201-7952223 GCTGAAATCTGGCGGGGAGCAGG - Intergenic
926166850 2:10526431-10526453 GCCGAAGCCTGGCTCCGGCCGGG - Intergenic
926247857 2:11133738-11133760 GCTCGGGTCTGGCTCTGGGCTGG - Intronic
926723999 2:15983546-15983568 GCTGAGGGCTGGCTGGTGGCTGG + Intergenic
927683144 2:25153496-25153518 ACTGAAGGCTGGCTGGGGACAGG - Intronic
929765902 2:44843875-44843897 GCTAGAGCCTGGCACGGGGCTGG + Intergenic
930803063 2:55462564-55462586 GCGGCAGCCTGGCTCGGGGAGGG + Intergenic
931254327 2:60556755-60556777 GGTGAAATCTGGCTGGGGGAGGG - Intergenic
931521739 2:63105787-63105809 GCTGAAGTTTTGCTCAGGACTGG + Intergenic
932005073 2:67919416-67919438 GCTGAAGGCTGCCTAGGGGAGGG + Intergenic
932323956 2:70842598-70842620 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
932377552 2:71251138-71251160 GCTGCAGCCTGGCGGGGGGCAGG - Intergenic
935100547 2:99991095-99991117 GGTGAAGACTGGGTAGGGGCAGG - Intronic
936092672 2:109511263-109511285 CCTGAAGCCTGACTCGGGACTGG + Intergenic
936822716 2:116542572-116542594 GCAGAAGTCTGCTTCAGGGCTGG - Intergenic
937226829 2:120375074-120375096 CCTGAAGACAGGCTTGGGGCTGG + Intergenic
937990071 2:127657268-127657290 GCTCAAGCCTGGTTCTGGGCTGG + Intronic
938143135 2:128812573-128812595 GCTGGAGTCTGGCAGTGGGCTGG + Intergenic
940720746 2:157279532-157279554 GCGGCAGCCTGGCTCGGGGAGGG - Intronic
941779900 2:169432546-169432568 GCTGTAGTCTGTCCTGGGGCTGG - Intergenic
942632255 2:177963543-177963565 GCTGAACTGTGGCTAGGTGCAGG - Intronic
943233617 2:185290247-185290269 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
946019983 2:216634109-216634131 GCGGAAGTCAGGCCCGGGGAGGG + Intronic
946360990 2:219219193-219219215 ACGGAATCCTGGCTCGGGGCAGG + Intronic
948519318 2:238525378-238525400 GCTGAAGCCTGGTCGGGGGCAGG + Intergenic
948586297 2:239021918-239021940 GCTGCAGTGGGGCTCGTGGCTGG - Intergenic
948654043 2:239465810-239465832 GCTGAAGGCTGTGTTGGGGCAGG - Intergenic
1170157013 20:13278239-13278261 TTTGAAGTCTGTCACGGGGCTGG - Intronic
1172106356 20:32519462-32519484 GCTGAAGTCAGGCCCGAGGATGG - Intronic
1172623072 20:36332186-36332208 GATGAGGTCTGGGTAGGGGCAGG + Intronic
1172888418 20:38246977-38246999 GGTGAAGCCTGGATCAGGGCGGG - Intronic
1173552947 20:43946106-43946128 GGTGATGTCTGGATGGGGGCAGG + Intronic
1174137480 20:48390618-48390640 GTTGAATTCTGGCTGGGTGCAGG + Intergenic
1174605340 20:51757312-51757334 GATAAAGTCAGGCTTGGGGCCGG - Intronic
1174761144 20:53208378-53208400 GCTGATGCCTGGCACAGGGCAGG - Intronic
1175171265 20:57082844-57082866 GGTGAAGTCGGGCTGGGGGAGGG + Intergenic
1175185553 20:57177781-57177803 GCTGAAGGCTGGGGCGGGGCTGG + Intronic
1176300819 21:5098184-5098206 GCTGGAGCCTGGGGCGGGGCAGG - Intergenic
1177242437 21:18476844-18476866 GCAGAAGTCAGTCTCAGGGCTGG + Intronic
1179856216 21:44163769-44163791 GCTGGAGCCTGGGGCGGGGCAGG + Intergenic
1180143835 21:45908985-45909007 GCTGGAGACTAGCTGGGGGCTGG - Intronic
1180161773 21:46001447-46001469 GCTGAGGTCTGGCGCGGGCAGGG - Intronic
1180951328 22:19721967-19721989 GGCGAGGTCTGGCTCGCGGCTGG - Intronic
1181025321 22:20124366-20124388 GCTGTGGGCTGGGTCGGGGCGGG + Intronic
1182033544 22:27179752-27179774 GCTGGAGTCTAGCTCCAGGCTGG + Intergenic
1182289932 22:29268935-29268957 GCAGAAGTTCGGCTTGGGGCTGG - Intronic
1182422630 22:30256037-30256059 GCTGCAGGCTGGCCTGGGGCTGG - Intergenic
1183455788 22:37922359-37922381 GCTGCAGACTGGAGCGGGGCCGG - Exonic
1184619062 22:45660442-45660464 GATGAAGTCTGGCTCTGTCCAGG + Intergenic
1184929903 22:47673238-47673260 GCTGCCTTCTGGCTTGGGGCTGG + Intergenic
1185018162 22:48357803-48357825 GCTGGATTCTGGCTAGAGGCAGG - Intergenic
1185033881 22:48460773-48460795 GCTGAGGTCTGGCTCTGGGATGG - Intergenic
1185106185 22:48871279-48871301 GCTGCAGACTGGCTCGGCCCCGG - Intergenic
1185272998 22:49937191-49937213 GCCGAAGCCTGGGTGGGGGCTGG + Intergenic
949245247 3:1919220-1919242 GCTAAAGCCTGGCTGGGGGAGGG - Intergenic
949804011 3:7934589-7934611 GCTGCAGTCTGGCTGGGGGAGGG + Intergenic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950179405 3:10900778-10900800 GCTGAAGTCTGGCTTGGTCTGGG + Intronic
950602347 3:14045865-14045887 GTTGAAGTCTTCCTGGGGGCGGG + Intronic
954224058 3:49171591-49171613 GCTGAAGTCGGGCTCTGGCGGGG - Exonic
956159847 3:66338707-66338729 GCTGTAGTTTGGCTAGGGGAAGG - Intronic
956790631 3:72677426-72677448 GCTGCAATCTGGGTCGGGACGGG - Intergenic
959059765 3:101605522-101605544 GCTGCAGCCTGGCTGGGGGAGGG - Intergenic
962435541 3:135363131-135363153 GCTGAAGACTGTCTAGGGGAGGG - Intergenic
962675190 3:137751100-137751122 GCTGCAGCCTGGCTAGGGGAGGG + Intergenic
964995018 3:162868204-162868226 GCTGAAGCCTGGTTGGGGGAGGG + Intergenic
965797015 3:172449753-172449775 GCTGATTTCTGGCTCTGAGCAGG - Intergenic
966834860 3:184041495-184041517 GCTGCAGTCTGACCCGAGGCTGG + Intergenic
968506908 4:974926-974948 GCTGAGGGCAGGCTCGGGGTGGG - Intronic
968603280 4:1520395-1520417 GCGGAAGCCAGGCTCGGGGAGGG + Intergenic
969268961 4:6085936-6085958 GCAGAGGCCTGGCTGGGGGCCGG - Intronic
969462370 4:7335580-7335602 GCTGCAGTCTTGCTGGAGGCGGG + Intronic
969605727 4:8201408-8201430 GCTGGAGGCTGGCCTGGGGCTGG + Intronic
973541789 4:51942134-51942156 GCGGGAGTCTGGGTGGGGGCAGG + Intergenic
975844011 4:78506465-78506487 GCTGTAGCCTGGCTGGGGGAGGG - Intronic
976477935 4:85506459-85506481 GCTGCAGCCTGGCTGGGGGAGGG - Intronic
980593995 4:134928780-134928802 GCTGCAGCCTGGCTGGGGGAAGG - Intergenic
985396750 4:189552579-189552601 GCTGAAGTCTGCGTTGGGGGTGG + Intergenic
986007360 5:3678908-3678930 GCTGCAGTGTAGCACGGGGCTGG - Intergenic
986304521 5:6505557-6505579 GCTGAACTCTGGCAGGCGGCTGG - Intergenic
987096590 5:14556048-14556070 GATGAAGACTGGCTCGGTCCAGG + Intergenic
987279724 5:16400663-16400685 GCTGCAGCCTGGCTTGGGGAGGG - Intergenic
987911722 5:24155321-24155343 GCTAAAGTCTTGCCCAGGGCAGG - Intronic
988381271 5:30499558-30499580 GCTGCAGTCTAGCTGGGGGAGGG - Intergenic
989651596 5:43696634-43696656 GCAGAAGTCTGCCACGGGGGTGG - Intronic
990749847 5:59002635-59002657 CCTCAGGTCTGGCTCTGGGCTGG - Intronic
991136747 5:63191310-63191332 TCTGGAGTCTGGCTTGGGTCGGG + Intergenic
993605642 5:89987593-89987615 GATAAAGTCTGGATCTGGGCTGG + Intergenic
997225877 5:132209076-132209098 CCTGGACTCTGGCTCTGGGCAGG - Intronic
998463712 5:142326558-142326580 GCTGAGGTCTGGCCTAGGGCTGG + Intergenic
999099632 5:149012636-149012658 GCTGAGGCCTGGCTTGGGGCGGG - Exonic
999419828 5:151431332-151431354 GCTGAACCCTCCCTCGGGGCTGG + Intergenic
1002139950 5:177132642-177132664 GCTGCAGCCCGGCTCGGTGCCGG + Intergenic
1002334417 5:178468206-178468228 GCTGGAGTCTGGGTGGGGTCTGG - Intronic
1002433882 5:179219878-179219900 GCTGGAGAGTGGCACGGGGCAGG - Intronic
1002634831 5:180602088-180602110 GCTGATGTCAGGCACAGGGCAGG + Exonic
1003647512 6:7926096-7926118 GCTGCAGCCTGGCTGGGGGAGGG + Intronic
1004158445 6:13191640-13191662 GAGGAAGTCTGGCTCTGGACTGG + Intronic
1004260753 6:14105579-14105601 GATGAAGGCTGGCTCTAGGCTGG + Intergenic
1006076469 6:31535780-31535802 GCTGAAGGCTGGCTGGGGCTTGG - Intronic
1013390245 6:109679253-109679275 GCTGGAGCCTGGCTGGGGGAGGG + Intronic
1013490248 6:110639915-110639937 GCAGAAGTCTGACTTGGGCCAGG + Intronic
1013578303 6:111507438-111507460 GCTGCAGCCTGGCTGGGGGAGGG - Intergenic
1019038119 6:169078932-169078954 ACTCAAATCTGGCTCTGGGCAGG + Intergenic
1019638822 7:2091434-2091456 GCTGATGTCTGGCTGGGGTCTGG + Intronic
1019733861 7:2641090-2641112 GCTGGGGTGTGGCTCGGGGCAGG - Intronic
1020774136 7:12432065-12432087 GCTGCAGCCTGGCTGGGGGAGGG - Intergenic
1023872803 7:44271910-44271932 GCTGAGGACTGGCTCTGGGCAGG + Intronic
1024926693 7:54623203-54623225 TCTGAAGACTGGCTCTGTGCTGG - Intergenic
1027701795 7:81478864-81478886 GCTGAAGCCTGGCAGGGGGAGGG + Intergenic
1027735312 7:81925273-81925295 GCTGAACTCTAGCACGGGGACGG - Intergenic
1028114494 7:86982088-86982110 GCGGCAGCCTGGCTCGGGGAGGG + Intronic
1028977820 7:96933549-96933571 TCTGAAGTCTGACTTGGGGTGGG - Intergenic
1034410990 7:150942152-150942174 GCTGGAGTCTGGTCAGGGGCTGG - Intergenic
1034718723 7:153267625-153267647 GCTGAACCCTGCCTTGGGGCAGG - Intergenic
1038766184 8:30429985-30430007 TCTGAAATCTGGCCCGGCGCAGG + Intronic
1043844405 8:85148342-85148364 GTTTAAGGCTGGCTGGGGGCAGG + Intergenic
1046879218 8:119290034-119290056 GCGGCAGCCTGGCTCGGGGAGGG - Intergenic
1047623794 8:126635130-126635152 GCTGCACTGTGGCTCAGGGCAGG + Intergenic
1048337722 8:133515232-133515254 GCTGAAGTCTTGCCAGGAGCAGG - Intronic
1048791275 8:138106348-138106370 GTTCAAGTCTGGCTCTAGGCCGG + Intergenic
1049194655 8:141308555-141308577 GCTGGATTATGGCTGGGGGCGGG - Intergenic
1049243606 8:141550654-141550676 GCTGGGGTCTGTCTGGGGGCCGG + Intergenic
1049243727 8:141550982-141551004 GCTGGGGTCTGTCTGGGGGCCGG + Intergenic
1049243875 8:141551392-141551414 GCTGGGGTCTGTCTGGGGGCCGG + Intergenic
1049243919 8:141551515-141551537 GCTGGGGTCTGTCTGGGGGCCGG + Intergenic
1049243935 8:141551556-141551578 GCTGGGGTCTGTCTGGGGGCTGG + Intergenic
1049310216 8:141930219-141930241 GCTGAGCTCTGCCTCTGGGCTGG - Intergenic
1049614669 8:143570894-143570916 GCTGAAGGGTGCTTCGGGGCCGG - Exonic
1051148309 9:14053513-14053535 GCAAAACTCTGTCTCGGGGCGGG + Intergenic
1052063781 9:23992098-23992120 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
1052437142 9:28443877-28443899 TCTGAAGCCTGGGTCTGGGCTGG + Intronic
1052741346 9:32395634-32395656 GATGAGGTCAGGCTCAGGGCCGG + Intronic
1053434463 9:38066389-38066411 GCTGAAGCTTGGCTTGGTGCAGG - Intronic
1053462694 9:38282821-38282843 GCAGAAGTGGGGCTGGGGGCTGG + Intergenic
1053489692 9:38489220-38489242 GCTGCTGTCTGGCTCTGGGCAGG + Intergenic
1055321746 9:75088820-75088842 TCGGAAGCCAGGCTCGGGGCCGG - Intronic
1056649465 9:88445570-88445592 GATGGAGTCTTGCTCTGGGCTGG + Intronic
1057670030 9:97078529-97078551 GCTGCTGTCTGGCCCCGGGCAGG + Intergenic
1060225143 9:121785914-121785936 ACTGAAATCTGGCTCTGGGAGGG + Intergenic
1060967816 9:127721383-127721405 GCCGGAGTCTGGCTTGGGGGTGG + Intronic
1061450527 9:130664823-130664845 GGTGAAGGCTGTCTTGGGGCTGG - Exonic
1061802788 9:133121262-133121284 GCTGATGTCAGGCTGGGGGGCGG + Intronic
1061913903 9:133739056-133739078 GCTGCAGCCTGACTCTGGGCTGG + Intronic
1186150634 X:6671315-6671337 CCTGAAGTCTTGCGTGGGGCGGG - Intergenic
1187548091 X:20272662-20272684 GTTGAGGTCTGGCTACGGGCTGG - Intergenic
1190530401 X:51368899-51368921 GCTACATTCTGGCTCAGGGCAGG - Intergenic
1190622260 X:52299128-52299150 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
1190683407 X:52849273-52849295 GCTGCAGCCTGGCTGGGGGAGGG - Intergenic
1190726408 X:53193291-53193313 ACGGGAGTCGGGCTCGGGGCCGG - Exonic
1191110872 X:56802460-56802482 ACTGAAGTCTGACTCTGTGCAGG - Intergenic
1191154030 X:57252148-57252170 GCTGAAGTTTGGCAGGGGGAGGG + Intergenic
1192143714 X:68666296-68666318 GCTGAAGTCAGGCTAGAGCCAGG - Intronic
1192395902 X:70780735-70780757 GCTGCAGCCTGGCTGGGGGAGGG + Intronic
1195508279 X:105684460-105684482 GCAGCAGCCTGGCTCGGGGAGGG + Intronic
1196385110 X:115140598-115140620 CCTGAATTCTGGCTTGGGGCAGG - Intronic
1201583104 Y:15531972-15531994 GCGGCAGTCTGGCTGGGGGTGGG - Intergenic