ID: 1087714152

View in Genome Browser
Species Human (GRCh38)
Location 11:101587483-101587505
Sequence TATCACATGTAGAATCAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087714146_1087714152 -6 Left 1087714146 11:101587466-101587488 CCCTGAGCCCTGACTCCTATCAC 0: 1
1: 0
2: 1
3: 28
4: 258
Right 1087714152 11:101587483-101587505 TATCACATGTAGAATCAACCGGG 0: 1
1: 0
2: 0
3: 8
4: 95
1087714147_1087714152 -7 Left 1087714147 11:101587467-101587489 CCTGAGCCCTGACTCCTATCACA 0: 1
1: 0
2: 8
3: 114
4: 1123
Right 1087714152 11:101587483-101587505 TATCACATGTAGAATCAACCGGG 0: 1
1: 0
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087714152 Original CRISPR TATCACATGTAGAATCAACC GGG Intronic
900652957 1:3739769-3739791 TCTAACCTGTAGAATCAACCCGG + Intergenic
900652987 1:3739985-3740007 TCTAACCTGTAGAATCAACCCGG + Intergenic
906300602 1:44678649-44678671 TTTCACATGTAGAATGAGACAGG - Intronic
909572652 1:77134683-77134705 TATCAGATGTAGAAGCAATGAGG - Intronic
914972522 1:152323172-152323194 TCTTACATGTAAAATCAACCTGG - Intronic
915964098 1:160291523-160291545 TACCAGGTGTAGCATCAACCTGG - Intronic
921139048 1:212287554-212287576 TCTCACAGTTAGAATCAAACTGG + Intronic
1063848306 10:10156642-10156664 TATCACATGTATTATTAACTAGG - Intergenic
1067775187 10:49159001-49159023 TATCACAGAAAGAATAAACCAGG + Intronic
1068406391 10:56595088-56595110 CATTACATGTAGCATCAACGTGG - Intergenic
1071179317 10:82964385-82964407 TAACACATGAAGAATCCCCCTGG + Intronic
1074332030 10:112523037-112523059 TTTCACATGTAGAATCATACAGG + Intronic
1081521220 11:43882964-43882986 TATGACATGTAGAAACTAACTGG - Intronic
1087714152 11:101587483-101587505 TATCACATGTAGAATCAACCGGG + Intronic
1092975506 12:13740961-13740983 TGACACATCTAGAATCAGCCTGG - Intronic
1097459884 12:59848256-59848278 AAGCTCATGGAGAATCAACCTGG - Intergenic
1097492632 12:60290164-60290186 TAATACTTTTAGAATCAACCAGG - Intergenic
1099886267 12:88534933-88534955 TATCTCATTTTGAATAAACCAGG + Intronic
1107574473 13:41702959-41702981 TTTCACATGAAGACTGAACCTGG + Intronic
1109758147 13:66788894-66788916 TAGCACATGTAGAATTGTCCTGG + Intronic
1110801925 13:79708395-79708417 TATCACATGTATAATTATCAGGG - Intergenic
1112851786 13:103715069-103715091 CATCACATGTAGCATCCATCAGG + Intergenic
1118435231 14:65765174-65765196 TATGACTTGTAGAATCCAACAGG - Intergenic
1120250145 14:82053225-82053247 TATAACGTGTAGAATAAAACTGG + Intergenic
1120710853 14:87791578-87791600 TATCAAATACACAATCAACCAGG + Intergenic
1124182697 15:27491514-27491536 TATCAACTGTAGAATCAAGGTGG - Intronic
1124431802 15:29614660-29614682 GATCCCATTTAGAACCAACCGGG + Intergenic
1127150129 15:56065838-56065860 TTTCAAATGTTGAACCAACCTGG - Intergenic
1127513477 15:59667582-59667604 TATCACATGTAGAATTTGACTGG + Intronic
1139224412 16:65220247-65220269 TAACTCATGTAGAGTGAACCAGG + Intergenic
1144182902 17:12769633-12769655 TCTCCTATGTAGAATCAACAAGG + Intergenic
1149238698 17:54623421-54623443 TATCACATGTTTATTCCACCTGG + Intergenic
1152831993 17:82503212-82503234 TGTCACATGCAGAATCAGGCTGG - Intergenic
1156482711 18:37446164-37446186 CATCACATGCACAATCCACCTGG - Intronic
1159380399 18:67650060-67650082 TATCATAAGTAGAATCAATATGG + Intergenic
1163774003 19:19207341-19207363 AATCACATACACAATCAACCTGG - Intergenic
930477419 2:51901031-51901053 TATGGCAGGTAGAATCAAGCAGG + Intergenic
931163767 2:59723080-59723102 TATAATTTGTAGAATCAGCCTGG + Intergenic
939668531 2:144980532-144980554 TGTCACATCTAAAATCAACATGG - Intergenic
940574883 2:155490202-155490224 TATCACATGTGGTATCAATAAGG + Intergenic
941111934 2:161425836-161425858 TATAACAAGTAAAATAAACCTGG + Exonic
944592483 2:201230605-201230627 TATAACATGTACAATCTGCCAGG + Intergenic
945308074 2:208278818-208278840 TAGCAAATACAGAATCAACCTGG - Intronic
1171091152 20:22286915-22286937 TATCACATGTAGTTTCCACATGG - Intergenic
1177214521 21:18111001-18111023 TATCTTATGTAGATTCAAACTGG + Intronic
1184264653 22:43340603-43340625 TATAACCTGAGGAATCAACCTGG - Intronic
951326323 3:21306725-21306747 TGCCACATGTAGAATAAAACTGG + Intergenic
955791223 3:62590597-62590619 TTTCATCTATAGAATCAACCTGG - Intronic
956212321 3:66814592-66814614 TATCACAGGTAAAAACAACTTGG - Intergenic
958599079 3:96270261-96270283 TATCACATGCACAAACAATCTGG - Intergenic
962590322 3:136883228-136883250 TATTACATGTAGAATAAAATTGG + Intronic
973272260 4:48273398-48273420 GAAGACATGCAGAATCAACCTGG + Intergenic
974100889 4:57414982-57415004 TAGCCCATGTAAGATCAACCTGG - Intergenic
976340564 4:83942360-83942382 TATCACCTCCAGAATCACCCAGG - Intergenic
984597887 4:181692194-181692216 TATCACATTTATAATCAACTTGG + Intergenic
985946588 5:3189546-3189568 AATCACATGTAGATTAAAACAGG + Intergenic
987928039 5:24366534-24366556 TATCCCAAGTAAAATCAGCCAGG - Intergenic
989643718 5:43606801-43606823 AAGCACTTGTAGAATCAAACTGG - Intronic
998702427 5:144718099-144718121 TATCCCATGTAGAAACAAACTGG - Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1001968117 5:175928825-175928847 CATCACATGCAGAAACAACAGGG + Intronic
1002249325 5:177914981-177915003 CATCACATGCAGAAACAACAGGG - Intergenic
1003511934 6:6788969-6788991 TATTACATGTAGAATTGAACTGG + Intergenic
1003610107 6:7605393-7605415 TATCACATCTCGAATCACCTTGG - Exonic
1005965658 6:30724713-30724735 GATCCCATTTAGAACCAACCAGG + Exonic
1009489917 6:64276472-64276494 TATCAAATCTAGAATCAATGAGG + Intronic
1011610096 6:89142261-89142283 TAGCACATGTAAAATCAATCTGG - Intergenic
1012424288 6:99097021-99097043 AGTCATATGTAGAATGAACCTGG + Intergenic
1014670082 6:124292139-124292161 TACCACTTTTAGAATCAGCCAGG - Intronic
1015492113 6:133838067-133838089 CATCCCATGCAGAATCAATCGGG + Intergenic
1017212628 6:151873841-151873863 TATCACATTTTGAAGCATCCAGG - Intronic
1018406589 6:163490535-163490557 CATCAGAAATAGAATCAACCAGG + Intronic
1020395440 7:7711193-7711215 TATCCCATGTAGCTTCTACCTGG - Intronic
1021902027 7:25295212-25295234 TATAACATGTCCAATCATCCAGG - Intergenic
1023480607 7:40629805-40629827 TATTACATGTAAAATTACCCTGG + Intronic
1023543843 7:41296419-41296441 TATCACAAGAAGAAGCTACCAGG + Intergenic
1028886075 7:95934679-95934701 CATCACATGTATTATCCACCTGG + Intronic
1030197321 7:106865236-106865258 AATCACACGTATAATCAACTTGG + Intergenic
1032202667 7:129833694-129833716 TTTCCCATGTAGAATCACTCTGG + Exonic
1033543308 7:142376652-142376674 GATCACATGTAGAAGCAGCAGGG - Intergenic
1033967544 7:146995133-146995155 TATCACAAATCGAATCAATCTGG - Intronic
1036436666 8:8741025-8741047 TCTCACATTTAGAATCTACAAGG + Intergenic
1038172006 8:25143935-25143957 TAACATATGTAGGATCTACCTGG + Intergenic
1038443747 8:27588928-27588950 TGGCACCTGTAGAAGCAACCAGG - Intergenic
1038698387 8:29826718-29826740 TAACACAAGCAGAAACAACCAGG + Intergenic
1039403133 8:37289870-37289892 GATCACATGTAGAGTCCAGCTGG - Intergenic
1041136999 8:54769433-54769455 TATCACCTGTAAAAGCAACTGGG - Intergenic
1041299395 8:56394911-56394933 TCTGACATGCAGAATCAAGCAGG + Intergenic
1041795094 8:61738638-61738660 TATCACATATGAGATCAACCTGG + Intergenic
1043540485 8:81256486-81256508 TTTCCCATGTAGAATCACTCTGG - Intergenic
1045822187 8:106352207-106352229 TCTCAGAGGTAGAATCAACCAGG + Intronic
1047134617 8:122062340-122062362 TTTCACATGTAGACTCCAACAGG + Intergenic
1055786830 9:79879322-79879344 TCTCACATGTAGGATCAAGAAGG + Intergenic
1058708375 9:107656489-107656511 TATTCCATGTGGAATCAACTGGG - Intergenic
1060028020 9:120189579-120189601 AATCACATGTAGAGGCAACTTGG - Intergenic
1187249381 X:17583094-17583116 AATGACATGTAGAAACAGCCTGG - Intronic
1188122991 X:26333681-26333703 TGTCATATGAAGAATCAACTGGG + Intergenic
1188513462 X:30960758-30960780 CATCACATGTCGACTTAACCTGG + Intronic
1192306288 X:69963477-69963499 TTTCACATGTAGAATCCCCAAGG + Intronic
1193639930 X:84000676-84000698 TATCATATATAGAATCAAATGGG - Intergenic
1194327724 X:92540825-92540847 TGACATATCTAGAATCAACCTGG - Intronic
1194875228 X:99178694-99178716 AAACACATGTAGTATCATCCAGG + Intergenic
1197390985 X:125864161-125864183 TTTCACATGTATAATCATCAAGG - Intergenic
1200636437 Y:5660043-5660065 TGACATATCTAGAATCAACCTGG - Intronic