ID: 1087714915

View in Genome Browser
Species Human (GRCh38)
Location 11:101596589-101596611
Sequence TAGTGGGCATGGAGGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 738
Summary {0: 1, 1: 0, 2: 5, 3: 72, 4: 660}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087714915 Original CRISPR TAGTGGGCATGGAGGGGGGA TGG Intronic
900874380 1:5331145-5331167 TGGTGGGCATGGCAGGGTGAGGG + Intergenic
900954132 1:5876324-5876346 CAGTGGTCAGGGAGGAGGGAGGG - Intronic
901619160 1:10568326-10568348 TAGTGGGAGTGGGGGGGGGGGGG - Intronic
902490289 1:16776351-16776373 TAGTGGGCAGGGGCGGGGGCAGG - Intronic
902542737 1:17166211-17166233 TGGTGGGCATGGTGGGTGGTGGG - Intergenic
903331712 1:22600058-22600080 AAGGGGGGATGGAGGGAGGAAGG + Intronic
904753805 1:32756995-32757017 GACTGAGCATGGAGGTGGGAGGG + Intronic
905348987 1:37331547-37331569 TAGGGGGCAGGGAGGGGGATGGG - Intergenic
905362932 1:37432768-37432790 TGGTGGGCAGGGAGGGGCGGTGG + Intergenic
905375007 1:37514389-37514411 GAGGGGGCGTGGAGGGAGGACGG - Intronic
906107666 1:43304633-43304655 CAGTGCGCATGGAAGGGGAAAGG + Intronic
906174996 1:43763453-43763475 TAGTTGGCATGGAGGAGTGGCGG + Intronic
906454583 1:45982769-45982791 TTGTGGGGATGGCAGGGGGAGGG - Intronic
906501294 1:46343138-46343160 CAGTGGGCAGGGATGGGGGGTGG - Intronic
906566327 1:46803758-46803780 TGGTGGGCCTGCAGGGAGGAGGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907355436 1:53869078-53869100 AAGTGGGCATGGAAGGTAGAGGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907933950 1:59025512-59025534 TGGTGGGCGTGGGGAGGGGAAGG - Intergenic
908131193 1:61077124-61077146 GAGGGGGCAGGGAGGGGGCAGGG - Intronic
908171113 1:61505478-61505500 TAATAGGCATGGTGGGGGAAGGG + Intergenic
908355557 1:63322929-63322951 TGGGGGGCAGGGAGAGGGGAGGG - Intergenic
908697658 1:66862767-66862789 TAGTGGGAAGGGAGGTGTGATGG - Intronic
909607623 1:77522594-77522616 GGGTGGGCAGGGAGGTGGGATGG - Intronic
910649294 1:89547798-89547820 TAGTGGGCGGGGAGGGGAGGGGG + Intronic
910745960 1:90575276-90575298 TAGTGGCCAGGGGGTGGGGAGGG + Intergenic
910938305 1:92505125-92505147 GAATGGGCAGGGAGGGGGTAGGG + Intergenic
912641097 1:111346700-111346722 TAGAGGGCAGGTAGGGGGAAGGG + Intronic
912813416 1:112810667-112810689 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
914863562 1:151406391-151406413 TAGTGGGGAAGGAAGGAGGAGGG + Exonic
915026865 1:152839047-152839069 TGGTGGGGGGGGAGGGGGGAGGG - Intergenic
915826544 1:159084287-159084309 AAGTGGGCTTGGAGGAGGGAAGG - Intronic
916030326 1:160871358-160871380 TGGTGGGCATGGGGTGCGGAGGG - Intergenic
918031305 1:180814883-180814905 TAGTTGGCCTGGGGTGGGGATGG + Intronic
918038496 1:180897697-180897719 AAAGGGGCATGGAGGGGTGAAGG - Intergenic
918282420 1:183020409-183020431 AAGGAGGGATGGAGGGGGGAGGG - Intergenic
918328701 1:183435140-183435162 TGGCGGGGAGGGAGGGGGGACGG - Intergenic
918816285 1:189189805-189189827 TACTGGACATGGAAGGAGGAAGG - Intergenic
919490281 1:198197949-198197971 TGGTGGGTATGGAGGAGGGTAGG + Intronic
919502102 1:198349973-198349995 GAGTGGGGATGGAGGTGGGATGG + Intergenic
919879683 1:201893485-201893507 TAAGGGGCTTGGAGAGGGGAGGG - Intergenic
919887627 1:201946383-201946405 TGGTGGGCAGGGAAGGGAGAGGG + Exonic
920406839 1:205721115-205721137 GAGGGGGCAGGGTGGGGGGATGG + Intronic
920417319 1:205807435-205807457 TCATGGGCCTGGAGTGGGGATGG + Intronic
920498803 1:206473394-206473416 CAGTGGGCATTGAGGGTGGTGGG + Intronic
920500050 1:206480180-206480202 GAGTGGGCAGGAAGGGGAGATGG + Intronic
921479281 1:215645184-215645206 TTGTGGGCATGAAGGGAGAAAGG + Intronic
922003508 1:221504529-221504551 ACCTGGGCATGGAGGGGAGAGGG - Intergenic
922433606 1:225581431-225581453 GAGTGGGAGTGGAGGGTGGAGGG + Intronic
922465896 1:225845478-225845500 GAGTGAGCTTGGAGGGGTGAGGG - Exonic
922472322 1:225883947-225883969 AAGAGAGCAGGGAGGGGGGATGG - Intergenic
922598824 1:226834497-226834519 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
922640085 1:227221531-227221553 TAGTGGGAAGGGAGGGTGGGTGG - Intronic
922851419 1:228736214-228736236 GAGTGGGCTTGGAGAGAGGAGGG + Intronic
923039017 1:230306394-230306416 TGGTGGGGGTGGAGGAGGGAAGG + Intergenic
923530151 1:234806179-234806201 TAGTGGGCAGGGGCGGGGGCAGG + Intergenic
1062894803 10:1095070-1095092 TAATGGGCATGGAGAGAGGAGGG + Intronic
1062894811 10:1095113-1095135 TAATGGGCATGGAGAGAGGAGGG + Intronic
1063434258 10:6017960-6017982 GAGAGAGCATGGAGGGGGTAGGG + Intronic
1063722096 10:8594506-8594528 TCGTGTTCGTGGAGGGGGGAGGG - Intergenic
1065007267 10:21391473-21391495 TAATGGGCATGGTGGGAGGAGGG + Intergenic
1067697529 10:48546826-48546848 TAGAGAGCATGCAGGGAGGAGGG + Intronic
1067991286 10:51215554-51215576 CAGGGGGCATGGAGGAGGAAGGG + Intronic
1068045505 10:51881160-51881182 TAGTGCGCATGAAGGGGAGAGGG + Intronic
1068725339 10:60294502-60294524 TAGGGGGCTTGCAGGGAGGATGG + Intronic
1069617231 10:69813897-69813919 AAATGGGCATGGGGGAGGGAGGG - Intronic
1069826373 10:71257424-71257446 GGGTGGGCCTGGAGGGGGAAGGG - Intronic
1070161317 10:73868309-73868331 GTGTGGGGATGGAGGTGGGAAGG - Intronic
1071187087 10:83058393-83058415 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1071300685 10:84253868-84253890 TAGTGGTCATGGGGAGGTGAAGG - Intronic
1071502203 10:86212067-86212089 TAGTGGGCATGGATTAGTGATGG - Intronic
1071764664 10:88649182-88649204 TGGTAGGGAGGGAGGGGGGAGGG + Intergenic
1072189604 10:93069034-93069056 GAGGGTGCATGGATGGGGGAAGG + Intergenic
1072190082 10:93071594-93071616 TGGTGGGCGGGGAGGGGGGTGGG - Intergenic
1072827133 10:98618587-98618609 TGGGGGGCATGGGGGAGGGACGG + Intronic
1073387828 10:103142139-103142161 CAGGGGGCAAGGATGGGGGAAGG + Intronic
1073894490 10:108139130-108139152 TTGTGGGCATGGAGTTAGGAAGG - Intergenic
1075656289 10:124163315-124163337 TAATGGGGATGGAGGGAGGGAGG + Intergenic
1075804333 10:125174628-125174650 TGGTGGGGATGGTGGGAGGAGGG - Intergenic
1076494912 10:130890753-130890775 AAGTGGGAAAGGAGGGGGAAGGG + Intergenic
1076749400 10:132535021-132535043 TGGGGGGCAGGGAGAGGGGAGGG + Intergenic
1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG + Intronic
1077138692 11:1014034-1014056 GGGTGGGCATGGAGCGAGGAGGG + Intronic
1077190770 11:1255215-1255237 TGGTGGGCATGGGGTGGGGGTGG - Exonic
1077287740 11:1775306-1775328 GAGAGGGGATGGAGGGGGGATGG + Intergenic
1077287754 11:1775351-1775373 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287758 11:1775362-1775384 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287768 11:1775395-1775417 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287793 11:1775473-1775495 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287797 11:1775484-1775506 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287801 11:1775495-1775517 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287811 11:1775528-1775550 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287825 11:1775573-1775595 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287829 11:1775584-1775606 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287839 11:1775617-1775639 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287881 11:1775740-1775762 GAGAGGGGATGGAGGGGGGATGG + Intergenic
1077287885 11:1775751-1775773 GAGGGGGGATGGAGAGGGGATGG + Intergenic
1077287889 11:1775762-1775784 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287893 11:1775773-1775795 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287897 11:1775784-1775806 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287910 11:1775818-1775840 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287914 11:1775829-1775851 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287926 11:1775863-1775885 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287936 11:1775896-1775918 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287940 11:1775907-1775929 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287959 11:1775963-1775985 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287963 11:1775974-1775996 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287967 11:1775985-1776007 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287977 11:1776018-1776040 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287992 11:1776063-1776085 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287996 11:1776074-1776096 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288000 11:1776085-1776107 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288010 11:1776118-1776140 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288036 11:1776197-1776219 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288051 11:1776242-1776264 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288066 11:1776287-1776309 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077331627 11:1986572-1986594 TGGGGGGCATGGCGGGGGGCGGG - Intergenic
1077642871 11:3897653-3897675 GGGTGGGCGTGGCGGGGGGAGGG - Intronic
1077908789 11:6557033-6557055 TAGTGTGGGTGGAGGGGTGAAGG - Exonic
1078605981 11:12776007-12776029 CAGTGGGCAGGGAGGGGTGCAGG + Intronic
1079245976 11:18752505-18752527 GAGTGGGCATGGACTGGGGGTGG + Intronic
1081370410 11:42293692-42293714 AAGTGGGGATGGTGAGGGGAGGG + Intergenic
1081438202 11:43051617-43051639 TACTGAGCAGGGAGAGGGGAGGG + Intergenic
1081583096 11:44365866-44365888 GTGTGGGCATGGATGGGGTAGGG - Intergenic
1082269781 11:50157397-50157419 TGGTGTGGCTGGAGGGGGGAGGG + Intergenic
1082315991 11:50723233-50723255 TGGTGGGGGTGGAGGGGGGAGGG - Intergenic
1083719516 11:64597525-64597547 CAGTGGACTTGGTGGGGGGATGG - Intronic
1084113963 11:67031112-67031134 TAGGGGGCAGGGTGGGGGCAGGG - Intronic
1084215765 11:67646097-67646119 AAGTGGGCAGGCAGGTGGGAGGG - Intronic
1085027480 11:73244992-73245014 GAGTGGGCCTGGAGGGGAGGAGG + Intergenic
1085452685 11:76644911-76644933 TAGTGTGCCTGGAGAGGGCATGG + Intergenic
1085958407 11:81429343-81429365 GAGTGGGAGTGGTGGGGGGAAGG + Intergenic
1087195824 11:95303357-95303379 TAGTGAGGATGGAGAGGAGAGGG + Intergenic
1087714915 11:101596589-101596611 TAGTGGGCATGGAGGGGGGATGG + Intronic
1088530515 11:110803489-110803511 TGGTGGGGGGGGAGGGGGGAGGG - Intergenic
1088814222 11:113410447-113410469 TAGGGGGACTGGAGGTGGGAGGG + Exonic
1088818429 11:113437065-113437087 TGGTAGGGATGGAGGTGGGAGGG + Intronic
1088949405 11:114551655-114551677 AACTGGGCAGGGAGGTGGGATGG + Intronic
1089329096 11:117677474-117677496 CAGGGGGCAGGGAGAGGGGAGGG + Intronic
1089733772 11:120535535-120535557 AAGTGGGCATGTAGGAGGGAAGG + Intronic
1090042227 11:123301297-123301319 TGTTGGGGAGGGAGGGGGGAGGG + Intergenic
1090331885 11:125939104-125939126 TTCTGGGAATGGAGGAGGGAAGG - Intergenic
1090582040 11:128171075-128171097 AATTTGGCATGGAGGGGTGATGG + Intergenic
1091161751 11:133429063-133429085 TAGTGGGTATGGAAAGGGAATGG + Intronic
1202814608 11_KI270721v1_random:41748-41770 TGGGGGGCATGGCGGGGGGCGGG - Intergenic
1091555836 12:1572840-1572862 CAGTGGCGGTGGAGGGGGGATGG + Intronic
1091721507 12:2817333-2817355 CCCTGGGCCTGGAGGGGGGAAGG + Intronic
1092045339 12:5428484-5428506 GGGTGGGGATGGAGGGGGTAGGG + Intergenic
1093108823 12:15123738-15123760 TAGTTGGGATGGAGAGGGAAGGG - Intronic
1093322131 12:17724737-17724759 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1093709536 12:22314205-22314227 TAGTGAGCATGGAGGAAGGAGGG - Intronic
1094196324 12:27753455-27753477 TAGTGGGGATAGGGGTGGGAGGG + Intronic
1096124169 12:49107503-49107525 CAGTGTGCATGGAGGTAGGAGGG - Intronic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096957081 12:55536993-55537015 TTGTGGGGGGGGAGGGGGGAGGG + Intergenic
1097093636 12:56527750-56527772 AAGGGGGCATGGTGGGGGGGTGG - Intronic
1097191734 12:57222653-57222675 AAGTGGGCTTGGAGAGGGCAGGG - Intronic
1097462215 12:59875885-59875907 TGGAGGGGATGGAGGGGGTATGG - Intergenic
1097542345 12:60956446-60956468 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1097704905 12:62858081-62858103 TAGGGGGCGTGGTGGGGTGATGG - Intronic
1097737136 12:63194772-63194794 AAGTGGCCAGGGAGGGGAGATGG - Intergenic
1097899425 12:64858185-64858207 TGGTGGGAATGGAGGGTGGGCGG - Intronic
1098381911 12:69878895-69878917 TGCTGGGCATGGGGGGGTGAGGG - Intronic
1100148252 12:91703832-91703854 TAGAGGGCAGGGAGTGGGCAGGG - Intergenic
1100209030 12:92381941-92381963 GAGGGGGGATGGAGGGAGGAAGG + Intergenic
1101120412 12:101573576-101573598 TAATTGGCATGGAGTGGGGCGGG - Intronic
1101321631 12:103678079-103678101 AGGTGGGGATGGATGGGGGAAGG - Intronic
1101429807 12:104617429-104617451 TGGGGGCCATGCAGGGGGGATGG - Intronic
1101723921 12:107374093-107374115 GAGTGGGCAGGGAAGGGGGCTGG + Intronic
1102575549 12:113853975-113853997 TGGTGGGCATGGTAGGGAGAAGG + Intronic
1103238915 12:119397805-119397827 AAGGGGGGAGGGAGGGGGGAGGG + Intronic
1103561659 12:121796051-121796073 TTGTGGTGATGGAGGGGGGCTGG + Intronic
1103586911 12:121962932-121962954 GAATGGGCAAGGAGGGGGCATGG + Intronic
1103846734 12:123907210-123907232 TCATGGTCATGGAGGGCGGAGGG + Intronic
1103932234 12:124457031-124457053 AGGTGGGCAGGGAGGCGGGAGGG - Intronic
1104176240 12:126335438-126335460 TCGAGGGCATGGAGTGGGGATGG - Intergenic
1104200207 12:126581481-126581503 TACTGGGCATGGCAGGCGGAAGG + Intergenic
1104356279 12:128089795-128089817 ATGTGGGCATGGTGGAGGGAGGG + Intergenic
1104463320 12:128971723-128971745 AAGGGAGGATGGAGGGGGGAAGG - Intronic
1104843216 12:131834428-131834450 GGGTGGGCGTGGAGGGGGGCAGG + Intronic
1104849218 12:131863293-131863315 AAGTGGGGAGGGAGGGGTGAAGG + Intergenic
1105802780 13:23923529-23923551 TGGGGTGCAGGGAGGGGGGAAGG + Intergenic
1105852439 13:24347820-24347842 TTGGGGGGGTGGAGGGGGGAGGG + Intergenic
1106020012 13:25905594-25905616 CAGAGGGCATGGAGAGGGGCCGG - Intronic
1106464363 13:29999639-29999661 TATTGGGAAAGGAGGAGGGAAGG - Intergenic
1106637715 13:31547194-31547216 GAGTGGACATTGAGGAGGGAGGG - Intergenic
1107061295 13:36162583-36162605 TGGTGGGTATGGAGGGGGTGTGG - Intergenic
1107804980 13:44145267-44145289 TAGTGGGAAAGGAGTGAGGATGG + Intronic
1110754914 13:79161509-79161531 TAGTATGGAGGGAGGGGGGAGGG + Intergenic
1112437275 13:99399459-99399481 TGGTGGGCATGGGTGGGGGACGG - Intergenic
1112441098 13:99425827-99425849 TAGAGGGCCTGGAGGAGGGGCGG + Intergenic
1113417908 13:110144935-110144957 TAGTGGGTATGAAGGGGTCACGG - Intergenic
1113637513 13:111929707-111929729 GGGGGGGCATGGAGGGAGGAAGG + Intergenic
1114459681 14:22878480-22878502 TGGTGGGTGTGGAGGGTGGAGGG - Exonic
1114502509 14:23181443-23181465 TGGTGGGGGTGGGGGGGGGATGG + Intronic
1115812282 14:37122748-37122770 TAGTGATCATGGAAGAGGGAAGG - Intronic
1116458363 14:45144306-45144328 TAGTGGGCGAGGGGGGTGGAGGG - Intronic
1116890654 14:50264727-50264749 AAGTGGGGAGGGAGGGAGGAAGG + Intronic
1117478552 14:56119683-56119705 TAGTGGGCAGTGAAAGGGGAGGG + Intronic
1118879025 14:69810609-69810631 TTGTGGGCTTGGGGTGGGGAAGG - Intergenic
1119162725 14:72466708-72466730 TAGTGGTTATGGATGGGGTAGGG + Intronic
1119522372 14:75295374-75295396 TAGGGGGCAGGGATGGGGGTGGG - Intergenic
1119727280 14:76929038-76929060 CGGTGGGCATGGAATGGGGAGGG + Intergenic
1120251541 14:82065542-82065564 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1120576350 14:86186069-86186091 CAGGAGGCAGGGAGGGGGGAGGG - Intergenic
1120737126 14:88065595-88065617 TATGGGGCATGGAGCGGGCAGGG + Intergenic
1120752365 14:88209692-88209714 AAATGGGCATGGAGGTGGGTGGG - Intronic
1121076918 14:91076679-91076701 GAGTGGGCATGGGTGAGGGATGG + Intronic
1121097050 14:91224742-91224764 TCGTGGGCATGGAGGTGGATGGG + Exonic
1121377309 14:93424718-93424740 TAGTGGGGGTGGAGGGGCAATGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121605459 14:95236875-95236897 TTGTGGGAATGGTGTGGGGAGGG + Intronic
1121996430 14:98606952-98606974 TAGTAGGCCTGGATGGGGGCAGG + Intergenic
1122166852 14:99832048-99832070 TAGTTGGAGTGGAGGGGGGCAGG - Intronic
1122422851 14:101588378-101588400 TTGTGGGGAGGGAGGGGGAAGGG - Intergenic
1122507479 14:102240870-102240892 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1122600697 14:102920273-102920295 TAGTGGGAGTGGATGGTGGATGG - Intergenic
1123989224 15:25671051-25671073 TAGTGGGAAGGGAGGGGATAAGG + Intergenic
1124035999 15:26054107-26054129 TGCTGGGCATAGAGGGAGGATGG + Intergenic
1124087141 15:26561417-26561439 TAGTGGGCAGGGGGGTGGGTGGG - Intronic
1124197786 15:27647874-27647896 AAGTGGGCATGGAGGAGGTCAGG + Intergenic
1124861589 15:33447432-33447454 AAGTGGGCATGGGGTGGGGAAGG - Intronic
1125163358 15:36673805-36673827 TAGTGTGCATTGAGGTGGCAAGG + Intronic
1125294261 15:38185198-38185220 TAGAGGAAATGGAGGGAGGAGGG + Intergenic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1125591285 15:40856081-40856103 GGGTGGGCATGTATGGGGGAAGG + Intronic
1126611402 15:50533139-50533161 TAGGAGGCATGGTGGGGGCAGGG - Intronic
1127469017 15:59273854-59273876 CAGTGAGCAGGGAGGGGGCAGGG - Intronic
1127496167 15:59514070-59514092 TTGGGGGCATGGGGGGGGCAAGG + Intronic
1127920174 15:63488160-63488182 TAGTGGGGAGGGAGGTGGAAAGG - Intergenic
1128307392 15:66608537-66608559 GAGTGGGGAGGGAGGAGGGAAGG + Intronic
1128322942 15:66705315-66705337 TAGAGGGCATTGATGGGGGCAGG + Intronic
1128370397 15:67035568-67035590 TCATGGGCATGGGGTGGGGATGG + Intergenic
1128393981 15:67204793-67204815 TAGTGGGCCTGGAGTGGAGAAGG - Intronic
1128725693 15:69986960-69986982 GAGGTGGCATGGAGGTGGGAGGG + Intergenic
1128762396 15:70226189-70226211 GAGTGGGCATGGGTGGGGGGAGG + Intergenic
1128818842 15:70634264-70634286 AAGTGGGGATGAAGGGCGGATGG + Intergenic
1129761306 15:78130799-78130821 TGGGGGGCAGGGAGCGGGGAGGG + Intronic
1129787003 15:78316260-78316282 GAGGGGGCATGGCGGGGGGCAGG - Intergenic
1130148212 15:81291730-81291752 TAATGGGGAGGGAGGGAGGAAGG + Intronic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1130289576 15:82585647-82585669 TAAAGGGCATGGTGGGGGAAGGG - Intronic
1131447586 15:92512766-92512788 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1132008437 15:98252559-98252581 CAGTGGGCTTGGAGGTGTGAAGG - Intergenic
1132081642 15:98871004-98871026 TCCTGGGCATGGAGGTGGAAAGG - Intronic
1132106521 15:99066752-99066774 TAGTGGGCTTGGAGGGTAGGTGG + Intergenic
1132120006 15:99168373-99168395 TTGTGGTCATGGAGGGGGGCTGG - Intronic
1132120245 15:99169579-99169601 CAGTGAGCAGGGAGTGGGGAGGG + Intronic
1132168224 15:99619057-99619079 TATTGAGGATGGAAGGGGGAAGG + Intronic
1132262864 15:100441534-100441556 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1132273845 15:100549304-100549326 TTGAGGGCATGGAGAGGGAATGG + Intergenic
1132841186 16:1979183-1979205 GGGTGGGCACGGTGGGGGGAGGG + Exonic
1133314259 16:4872465-4872487 GGGTGGGCATGGTGGGGGGGCGG + Intronic
1133413635 16:5589071-5589093 CAGTGGGTATGGAGTGGGGTGGG + Intergenic
1133833546 16:9346532-9346554 GACTGGGGATGGAGTGGGGATGG - Intergenic
1133970139 16:10561481-10561503 GAGTGGGCACAGAGGTGGGAGGG + Intronic
1134390362 16:13814320-13814342 TAGTGGTCAAGGAAGGGGAAGGG + Intergenic
1135025560 16:18996634-18996656 AAGGGGGAATGGAGGGCGGAAGG + Intronic
1135139476 16:19909229-19909251 TAGTTGGGATGGGGAGGGGAGGG + Intergenic
1135429042 16:22366633-22366655 TATTGGGCAGGGAGGGGAGGGGG + Intronic
1135631566 16:24039616-24039638 TGCTGGGGATGGAGGTGGGAAGG + Intronic
1136233722 16:28902515-28902537 TAGGGGGCATCGAGGGTTGAGGG - Intronic
1136379178 16:29884083-29884105 TAGTGGACTGGGAGTGGGGAAGG - Intronic
1136484992 16:30565908-30565930 TAGGGGACAGGGAGTGGGGAAGG - Intergenic
1136619223 16:31416991-31417013 GAGGGGGGAGGGAGGGGGGAAGG - Intronic
1137054291 16:35735936-35735958 TACCGGGCTTGGATGGGGGACGG + Intergenic
1137225244 16:46498769-46498791 TAGTGGGAATGGAGTGAGTAGGG - Intergenic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1137583746 16:49651428-49651450 TGCTGGGCATGCAGGGGGGTGGG - Intronic
1137982429 16:53081177-53081199 TACAGGGCATGGAGGCAGGATGG + Intronic
1138251543 16:55505653-55505675 TGGTGGGATTGGAGGGGGAAGGG - Exonic
1138350190 16:56342209-56342231 GTGTGGGCCTGGAGTGGGGAAGG + Intronic
1138562105 16:57807416-57807438 CAGTGGGCATGGAGAGGTGGTGG + Intronic
1139136065 16:64206191-64206213 AAGTGGGCAGGGTGGGGGGTGGG + Intergenic
1139376628 16:66502767-66502789 TACTGTGGAAGGAGGGGGGAAGG - Intronic
1139512844 16:67437124-67437146 CAGTGGGCATGAAGTGGGGGTGG - Exonic
1139527614 16:67526439-67526461 GGGTGGGCATGGTAGGGGGAGGG + Intronic
1141044997 16:80708050-80708072 TATGGGGCATGAAGGGGGAAAGG - Intronic
1141172844 16:81702030-81702052 TAAGGGACATGGAGGAGGGAGGG - Intronic
1141497169 16:84418313-84418335 TAAGGGGCAAGGAGGGGTGAGGG - Intronic
1203087445 16_KI270728v1_random:1191787-1191809 AAGAGGGCATGGAGAGGGGAGGG + Intergenic
1143235007 17:5392194-5392216 TTGTAGGCATGCAGGTGGGATGG - Intronic
1144097737 17:11917081-11917103 AAGCGGGGATGGAGTGGGGAAGG + Intronic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1145279636 17:21458027-21458049 AAGGGAGCATGGAGGGGAGATGG + Intergenic
1145398242 17:22512455-22512477 AAGGGAGCATGGAGGGGAGATGG - Intergenic
1146031408 17:29369192-29369214 TAGAGGGCTTGGATGGGGGAGGG + Intergenic
1146178325 17:30680731-30680753 TGGTGGCCTTGGAGGTGGGAGGG + Intergenic
1146477527 17:33174961-33174983 TAGGGGGCAGGGAGAGAGGAGGG - Intronic
1146660090 17:34659827-34659849 TAATTGGCATGGGGGGGGGCAGG - Intergenic
1146821170 17:35984524-35984546 CTGAGGGCATGGAGGAGGGAAGG + Intronic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1146965521 17:37025482-37025504 CAGTGGCCATTGACGGGGGAGGG + Intronic
1147145094 17:38479923-38479945 CAGGGGGCATGGGGAGGGGAGGG + Intronic
1148018650 17:44539632-44539654 AAGTGGGAAAGGAGGAGGGAAGG + Intergenic
1148071438 17:44911108-44911130 TGCTGGGCATTGAGGTGGGAAGG + Intronic
1148201618 17:45753365-45753387 GTGTGCGCATGGATGGGGGAAGG + Intergenic
1148201625 17:45753396-45753418 GTGTGCGCATGGATGGGGGAAGG + Intergenic
1148201633 17:45753427-45753449 GTGTGCGCATGGATGGGGGAGGG + Intergenic
1148201641 17:45753458-45753480 GTGTGCGCATGGATGGGGGAGGG + Intergenic
1148201648 17:45753489-45753511 GTGTGCGCATGGATGGGGGAAGG + Intergenic
1148559948 17:48600269-48600291 TTGTGGGCAGGGAGGAGGCAGGG - Intronic
1149914805 17:60599662-60599684 GACTGGGAATGGAGGAGGGAGGG - Intergenic
1150500465 17:65646070-65646092 TAGTGGGCAGGGCAGGAGGAAGG - Intronic
1151461566 17:74257345-74257367 TACCGGGCATGGAGGTGGAAGGG - Intronic
1151569828 17:74920727-74920749 TGGAGGGAGTGGAGGGGGGAGGG + Intronic
1151811680 17:76447022-76447044 CAGTGGGCAGGCAGGAGGGAGGG - Intronic
1151954736 17:77374572-77374594 TGGTGGGCCGGGAGGGGGAAAGG + Intronic
1152655561 17:81517762-81517784 GAGTGGGACTGGAGGGGGGGGGG - Intronic
1153215528 18:2816929-2816951 TAGTGTGCCTGGAGAGGGCATGG + Intergenic
1153781094 18:8495729-8495751 GAGAGGGCAGGGAGAGGGGAGGG - Intergenic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1155113786 18:22743876-22743898 TGGGGTGCAGGGAGGGGGGAGGG - Intergenic
1155869608 18:31009498-31009520 TAGTGGGCATGGATGGATAAAGG - Intronic
1156264246 18:35471745-35471767 TGGGGTGCAGGGAGGGGGGAGGG - Intronic
1156561129 18:38127017-38127039 TGGTGGGGGTGGAGGGGGGCAGG - Intergenic
1157386221 18:47261492-47261514 CACTGGGCATGGAGGGGTGAAGG - Intergenic
1158644099 18:59228937-59228959 TAGTGGACATGAAGAGGGCAAGG + Intronic
1159034401 18:63263115-63263137 TAGGGGGCAGCGAGGGTGGACGG + Intronic
1159108176 18:64027124-64027146 TAGTGGAGATGGAGGGGCGGGGG + Intergenic
1159241105 18:65744971-65744993 CAGTGGGCATGGAGTGGAGGGGG + Intergenic
1160686506 19:439206-439228 AAGTGGGCAGGGAGGGGGCTGGG + Intronic
1160947126 19:1648808-1648830 CACTGGGCATGGGGGGGGGGGGG + Intronic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161422008 19:4181136-4181158 AAGAGGGCAGGGAGGGGGCAAGG - Intronic
1161426936 19:4208829-4208851 TAGTGTGGATGCAGGGAGGAGGG - Intronic
1161711828 19:5853036-5853058 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
1161821598 19:6533693-6533715 GAGGGGGCAGGGAAGGGGGAAGG - Intronic
1162145816 19:8611437-8611459 GAATGGGGCTGGAGGGGGGATGG + Intergenic
1162980275 19:14234722-14234744 TGGTGGCCTTGGAGGTGGGAGGG - Intergenic
1163093821 19:15041287-15041309 GAGGGGGGAGGGAGGGGGGAGGG - Intergenic
1164202644 19:23031268-23031290 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1164258613 19:23550495-23550517 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1164711344 19:30359270-30359292 CAGTGTGCATGGTGTGGGGAGGG + Intronic
1165013848 19:32866797-32866819 CAGAGGGGATGGAGGAGGGACGG - Intronic
1165149863 19:33753976-33753998 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165149881 19:33754016-33754038 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165378263 19:35459279-35459301 CAGTGGGCATGGAGAGGGTCTGG + Intergenic
1166687260 19:44802795-44802817 GAGTGGGCATGGCTGGGGTAGGG + Intergenic
1166829465 19:45630095-45630117 TGGTGGGCATGGGGGGAGGATGG - Intronic
1166853550 19:45771419-45771441 TAGGGCGCGTGGAGGGGCGAAGG + Intronic
1167043970 19:47039377-47039399 TGGTGGGCATGGTTGGAGGAGGG - Intronic
1167737017 19:51300919-51300941 CAGAGGGGATGGAGGAGGGATGG + Intergenic
1167872696 19:52386298-52386320 TAGAGAGCATGGAGGTGGGGAGG + Intergenic
1167900908 19:52621645-52621667 TAGGAGGAATGGAGGGTGGATGG - Intronic
1202631919 1_KI270706v1_random:7986-8008 TGGTGTGGAAGGAGGGGGGAGGG - Intergenic
925017594 2:543654-543676 TAGGAGGCAGGGAGGGGGGAGGG + Intergenic
925017642 2:543784-543806 TGGGAGGCAGGGAGGGGGGAGGG + Intergenic
925033901 2:671909-671931 GAGAGGGCAGGGAGGAGGGAGGG + Intronic
925068952 2:951141-951163 GAGGGGGCGTGGAGGGAGGAGGG - Intronic
925178519 2:1801163-1801185 TTGTGGGCATGGAGGGGGTTAGG + Intronic
925366606 2:3315638-3315660 TAGGGGGTGTGGATGGGGGATGG - Intronic
925421474 2:3716252-3716274 TAGAGGGCAGGGAGGTGAGAAGG + Intronic
925521768 2:4754430-4754452 TTGTGGGGGTTGAGGGGGGAAGG + Intergenic
926240480 2:11081160-11081182 AGGGAGGCATGGAGGGGGGAGGG - Intergenic
927053065 2:19348856-19348878 TCTTGGGCAGGGAGGGCGGAAGG - Intergenic
927856340 2:26530098-26530120 TACTGGGGATGAAGAGGGGAGGG + Intronic
927864888 2:26582023-26582045 GAGTGAGCGTGGAGGGGCGATGG + Intronic
928129247 2:28637761-28637783 GAGTGGGCAAGGAGGTGAGAAGG - Intronic
928494403 2:31817449-31817471 AAGTGGGCAAGGAGGGAGGTGGG - Intergenic
929087314 2:38181328-38181350 TAATGAGCATGGAGAAGGGAGGG - Intergenic
929410245 2:41691220-41691242 TAATGTGCAAGGAGGTGGGAGGG + Intergenic
932114031 2:69029042-69029064 TAGTAGAGATGGAGGGGGGGGGG - Intronic
932687380 2:73883515-73883537 TGGTGGGGCTGGAGTGGGGAGGG + Intergenic
932777366 2:74536266-74536288 GAGGTGGCATGGAGGTGGGAGGG - Intronic
932870581 2:75394254-75394276 AAGTGGCCATGGTGGAGGGATGG - Intergenic
933708665 2:85309382-85309404 TGGTGGGCATGGAGCGTGGCGGG - Exonic
933779702 2:85792965-85792987 TGATGGGCATGAAGGGGGGCAGG - Intergenic
934766257 2:96881734-96881756 CAGGGGGCAGGGAGGGGGGAGGG + Intronic
935117336 2:100147547-100147569 AAATGGGCAAGGAGGGAGGAGGG + Intergenic
935639239 2:105275072-105275094 TTGTGGGCCTGGAGGAGGGAGGG - Intronic
936288540 2:111200220-111200242 TAGGGGGCAGGGAGGGGAGTGGG - Intergenic
936558780 2:113518577-113518599 TAGTGGGCATGGAAGGGAGGGGG + Intergenic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937460959 2:122085561-122085583 TTGGGGGCATGGCAGGGGGAAGG - Intergenic
937857691 2:126684468-126684490 TAGTGGGCATGGTGGTGGGAGGG - Intronic
938228193 2:129635868-129635890 GGGTGGCCATGGAGGGCGGATGG - Intergenic
940194999 2:151084033-151084055 GAGTTGGAATGGAGGCGGGAAGG + Intergenic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
940955250 2:159720025-159720047 TCTTGGGGCTGGAGGGGGGAGGG - Intronic
941170706 2:162132392-162132414 TAGTGGGAGTGCAGGGGAGAAGG - Intergenic
941650196 2:168084172-168084194 AGGTGGGCATGGTGGGGGGAAGG + Intronic
942143658 2:173003290-173003312 TGGCGGGCAGGGAGAGGGGAAGG + Intronic
942305041 2:174599196-174599218 GAGTGGGAATGGTGGGGGCAGGG + Intronic
942836339 2:180302852-180302874 TGGGGTGCAGGGAGGGGGGAGGG + Intergenic
943792925 2:191955131-191955153 TGGGGGGCGGGGAGGGGGGAGGG + Intronic
945376706 2:209085122-209085144 AACTGGGCAGGGAGTGGGGAAGG - Intergenic
945769840 2:214029471-214029493 TAGTGGGCGGGGAGAGGGGAAGG + Intronic
946187729 2:217990743-217990765 TGGTGGGCATGGCAGGTGGAGGG - Intronic
946322327 2:218961108-218961130 TGCTGGGCGTGGAGTGGGGACGG + Exonic
946401653 2:219471733-219471755 GAGTGGGCAAGGATGGGGCAAGG - Intronic
946988000 2:225295518-225295540 TAGTGGGCATGGAGAAGAGATGG - Intergenic
947179431 2:227399033-227399055 AAGGAGGCAGGGAGGGGGGAGGG + Intergenic
947304876 2:228734467-228734489 TAGGGGGAATGGAGGGGAAATGG - Intergenic
947398694 2:229712466-229712488 TAGTGGGAATGGATGGGAGAAGG - Intronic
947885442 2:233566148-233566170 CACTGGGGAGGGAGGGGGGAAGG + Intronic
948163569 2:235844284-235844306 GAGTGGGTTTGGAGGGGGCAAGG + Intronic
948208141 2:236173522-236173544 CAGAGGGCACGGAGGGGTGAGGG + Intergenic
948403786 2:237702764-237702786 TACTGGGCAAGGAGGTGGCAGGG + Intronic
948408361 2:237739953-237739975 TTGTGGGAATGGAGGAGGGGAGG + Intronic
948871924 2:240805043-240805065 AAGTGGGGAGGGAGAGGGGAGGG + Intronic
948871933 2:240805065-240805087 GAGAGGGCAGGGAGAGGGGAGGG + Intronic
948871968 2:240805142-240805164 GAGTGGGGAGGGAGGCGGGAGGG + Intronic
1168909706 20:1438088-1438110 TAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1169025668 20:2369158-2369180 GGGTGGGCAGGGTGGGGGGAGGG - Intergenic
1170475876 20:16713969-16713991 GGGTGGGAATGGAGGGTGGAAGG + Intergenic
1172032375 20:31991097-31991119 GAGTGGGCAGGGAGGTGGGCAGG + Intronic
1172407355 20:34699675-34699697 AAGGGGGCACGGAGGGGGGCAGG + Intronic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1173014675 20:39214427-39214449 AAGTGGGTGTGAAGGGGGGAAGG + Intergenic
1173038498 20:39436070-39436092 TCGTGGGCATGGAGAGTAGAAGG - Intergenic
1174863760 20:54116059-54116081 TAGTGGGGGTGGCGGGGGGGCGG - Intergenic
1175050155 20:56147912-56147934 CAGTGGGGACGGAAGGGGGACGG - Intergenic
1175197293 20:57253084-57253106 AAGTGGGGATGGAAGGGGGTGGG - Intronic
1175253762 20:57625818-57625840 AAGTGGGCATGGACAGGGCATGG + Intergenic
1175590408 20:60185598-60185620 TGGGGGGCGGGGAGGGGGGAGGG - Intergenic
1175871937 20:62213134-62213156 GAGTGGGGATGGGTGGGGGAAGG + Intergenic
1175872029 20:62213354-62213376 GAGTGGGGATGGGTGGGGGAAGG + Intergenic
1175872039 20:62213378-62213400 GAGTGGGGATGGGTGGGGGAAGG + Intergenic
1175890585 20:62314164-62314186 GAGTGGGCACGGAGAGGCGAGGG + Intronic
1175890592 20:62314192-62314214 GAGTGGGCATGGAGAGGTGAAGG + Intronic
1177167687 21:17621340-17621362 TAGTGAGGATGGGGTGGGGACGG + Intergenic
1178441460 21:32602059-32602081 TAGAGGGCAGGGAGAGGGGGAGG - Intronic
1178558513 21:33616072-33616094 TGGTGGGGTTGGGGGGGGGAGGG - Intronic
1179114394 21:38476699-38476721 TAGTCTACAAGGAGGGGGGAAGG - Intronic
1180169178 21:46049076-46049098 TAGAGGGCATGGAGGGCGGTGGG - Intergenic
1181528482 22:23502871-23502893 GATTGGGGATGGAGGGTGGAGGG - Intergenic
1182294978 22:29307185-29307207 TGGTGCGCATGGACGGGGGTGGG + Intronic
1182980108 22:34661820-34661842 CAGTGGGTATGGTGTGGGGAAGG - Intergenic
1183093335 22:35538444-35538466 AAGTGGGTGGGGAGGGGGGAAGG + Intergenic
1183265011 22:36819496-36819518 AAGTGAGCCTGGAGGTGGGATGG + Intergenic
1183384992 22:37509577-37509599 TCGTGGACATGGAGTGGGGGTGG - Intronic
1183404418 22:37623485-37623507 GAGTGGGCAGGGAGTGGGGTAGG - Intronic
1183744425 22:39684885-39684907 TACTAGGAATGGAGGTGGGAGGG + Intronic
1183948296 22:41339032-41339054 TCGTGGGCGTGGAGGGGAGAAGG - Exonic
1184035864 22:41917803-41917825 TAGTGGTAGTGGAGGGGGGCAGG - Intergenic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184154866 22:42660850-42660872 TAGTGTGCCTGGAGAGGGCATGG - Intergenic
1184257421 22:43295183-43295205 AGGTGGGCATGGAGGGGCCAGGG - Intronic
1184315158 22:43682134-43682156 TGGGGTGCATGGTGGGGGGATGG + Intronic
1185369799 22:50455787-50455809 TAGAGGGCTTGGAAGGGGGTGGG - Intronic
1203255435 22_KI270733v1_random:135399-135421 TGGTGGGGGTGGGGGGGGGAGGG + Intergenic
949287498 3:2424206-2424228 TAGGGTGGAGGGAGGGGGGAGGG - Intronic
949753152 3:7377497-7377519 TGGTGGTGATGGAGGTGGGAAGG + Intronic
950630203 3:14277120-14277142 AAGTGGGGAGGGTGGGGGGAGGG - Intergenic
951681033 3:25294808-25294830 AAGAGGGAGTGGAGGGGGGAAGG + Intronic
953280383 3:41548658-41548680 TAGTGGGCAGGGAGGGTGGGTGG - Intronic
953557167 3:43955550-43955572 TACTGGACACGGAGAGGGGAAGG - Intergenic
955163498 3:56488066-56488088 TAGTGGGAATTGAGGCAGGAGGG - Intergenic
955512484 3:59695370-59695392 TAGGGGAAATGGAGGGTGGAGGG - Intergenic
955565753 3:60243432-60243454 TACTGGCCATGGAGAGGCGATGG + Intronic
956096521 3:65722041-65722063 TAGTAGGATTGGAGGAGGGAAGG - Intronic
956175188 3:66466213-66466235 TAGTAGACATGGTGGGGGGAGGG + Intronic
956560731 3:70571370-70571392 TTGGGGGCATGGAGAGAGGAGGG - Intergenic
956788526 3:72662398-72662420 GGGTGGGCATGATGGGGGGAGGG - Intergenic
959401624 3:105909304-105909326 TAGTGGGCAGGGTTTGGGGAGGG - Intergenic
959543854 3:107571123-107571145 AAGGGGGAATGGAGGGTGGAAGG + Intronic
960456395 3:117878189-117878211 TAGTGTGCCTGGAGAGGGCATGG + Intergenic
961524949 3:127490780-127490802 GGGTGGGCATGGTGGGGGTAGGG - Intergenic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
961939176 3:130619688-130619710 TAATGGGAATGGAAGAGGGAGGG + Intronic
962698489 3:137974218-137974240 AATTGGGGATGAAGGGGGGAAGG - Intergenic
963632065 3:147745757-147745779 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
963789361 3:149567882-149567904 AAGTGGGCATGGAAGTGGGATGG - Intronic
964383336 3:156120515-156120537 GAGTGGGCAGGGACGAGGGAGGG + Intronic
964411583 3:156403420-156403442 TAGTGGGCAGGTAAGGGGAAGGG + Intronic
966398596 3:179525390-179525412 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
967982391 3:195073478-195073500 TTGTGGGCATGAGGGGGGGAGGG - Intronic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968274357 3:197428553-197428575 GAGTGGTGATGGAGGTGGGAGGG + Intergenic
968278667 3:197459406-197459428 TAGTGGGGATGCAGTCGGGAGGG + Intergenic
968569924 4:1334018-1334040 TGGTGGGCATGGGGTGGGCATGG - Intronic
968569956 4:1334116-1334138 TGGTGGGCATGGGGTGGGCATGG - Intronic
969875585 4:10133561-10133583 CAGAGGGCATGGATGGGGGTGGG - Intergenic
971664331 4:29462184-29462206 GAGGGGGGATGGAGGGAGGAGGG + Intergenic
972402617 4:38719368-38719390 AGGTGTGCATGGAGGTGGGAGGG + Intergenic
973750975 4:54021058-54021080 AAGGGGGAATGGAGGGTGGAAGG - Intronic
973822746 4:54677243-54677265 GAGTGGGGATGGGGGCGGGAGGG - Intronic
974180650 4:58380067-58380089 TCCTGGGCATGGAGTGGAGAGGG + Intergenic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
974379577 4:61121449-61121471 TGGAGGGCATGGAGGGGGAAAGG - Intergenic
974758354 4:66242823-66242845 GGGTGGGCGGGGAGGGGGGAGGG - Intergenic
975036762 4:69694242-69694264 TAGGGTGGAGGGAGGGGGGAGGG - Intergenic
975151923 4:71032458-71032480 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
976214072 4:82699134-82699156 TAGATGGCAGGGTGGGGGGATGG - Intronic
976998784 4:91468353-91468375 TGGTGTGCAGGGAGGGGAGAGGG + Intronic
977003890 4:91541369-91541391 TGGTGTGCAGGGAGGGGAGAGGG - Intronic
978443592 4:108759710-108759732 TAGTGGGAATGGGGAGGGGTGGG + Intronic
979913836 4:126405174-126405196 CTCTGGGCATGGAGTGGGGATGG - Intergenic
980544899 4:134246617-134246639 TTGTGGGGAGGGGGGGGGGAGGG - Intergenic
981002324 4:139839819-139839841 TAGTGGATATGAAGGGGAGATGG + Intronic
981116324 4:140995115-140995137 TAGTAGGGTTGGAGTGGGGATGG - Intronic
981482867 4:145256000-145256022 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
981574344 4:146188612-146188634 GAGTAGGCATGGAAGGTGGAAGG + Intronic
982547244 4:156749277-156749299 CAGTGGGCATGGAGAGTGGGGGG + Intergenic
983058618 4:163129056-163129078 TGGTGGGGGTGGAGGGCGGAGGG + Exonic
983075406 4:163319638-163319660 TAGTGGGAAGGTATGGGGGATGG + Intergenic
983574924 4:169250684-169250706 TAGTGGGGATGGGGGTAGGAGGG + Intronic
984364945 4:178786299-178786321 TAGGGGGTGTGGTGGGGGGAGGG + Intergenic
984607599 4:181803632-181803654 TAGTGAGCATGGAGGTCAGAGGG + Intergenic
984686715 4:182677263-182677285 TAGTGGGCATGATGGTGGGGAGG - Intronic
984720791 4:182970844-182970866 GAGTGGGGATGTAGGGAGGAAGG + Intergenic
984815369 4:183831128-183831150 GAGGGGGGATGGTGGGGGGATGG + Intergenic
985141592 4:186845536-186845558 TAGTGGACATGAAGGGGAAATGG + Intergenic
986352512 5:6893691-6893713 AAGTTGCCATGGAGGAGGGATGG + Intergenic
987374274 5:17218747-17218769 TTCTGGAAATGGAGGGGGGACGG - Intronic
988418357 5:30974773-30974795 AGGTGGGCATGGAGGGGGTCTGG - Intergenic
988444942 5:31275345-31275367 GAGTGGGGAGGGAGGTGGGAGGG - Intronic
988861789 5:35288820-35288842 TAGTGGGGAGTGATGGGGGAAGG - Intergenic
989622804 5:43401323-43401345 TTGGGGGCATGGAGAGTGGATGG + Intronic
991405075 5:66293656-66293678 TGGGGGGCATGGATGGGGGCAGG - Intergenic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
992514814 5:77480674-77480696 TAGGGTGCGGGGAGGGGGGAGGG + Intronic
993223747 5:85137966-85137988 TGGTGGGGTGGGAGGGGGGACGG - Intergenic
993515061 5:88821763-88821785 AGCTGGGCATGGAGTGGGGAGGG + Intronic
993521234 5:88904264-88904286 TAGGGGGTCGGGAGGGGGGAGGG - Intergenic
993742813 5:91561371-91561393 TGGGGTGCAGGGAGGGGGGAGGG + Intergenic
993892605 5:93491356-93491378 TAGTGGTGATGGTGGGGGGGTGG + Intergenic
993998636 5:94751958-94751980 TGGGGTGCAGGGAGGGGGGAGGG + Intronic
994033032 5:95167057-95167079 TAGGGTGCAGGGAGTGGGGAAGG - Intronic
994188512 5:96841536-96841558 TTGTGGGCATTGTGGGGGGGTGG - Intronic
994547616 5:101185988-101186010 TGGGGTGCAGGGAGGGGGGAGGG + Intergenic
994989399 5:106979641-106979663 TAGGAGGAATGGAGGGTGGAAGG - Intergenic
995322119 5:110847365-110847387 TAGTGGGCGGGAAGTGGGGATGG - Intergenic
995367310 5:111377500-111377522 GAGTGAGAATGGAGGGGGGTGGG + Intronic
996276932 5:121678177-121678199 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
996957156 5:129197233-129197255 CAGTGGGCAGGGAAGGTGGAGGG - Intergenic
997168461 5:131688037-131688059 TAGGTGGCAGGGAGAGGGGATGG + Intronic
997310688 5:132878468-132878490 TATTGAGGAGGGAGGGGGGAAGG + Exonic
997585668 5:135041549-135041571 TAGCGTGCAGGGAGGGGGGAAGG - Intronic
997640181 5:135443787-135443809 AAGTGGGCATGGTTGGGGAATGG + Intergenic
998549109 5:143059559-143059581 TAATGGGACTGGAGGGGGAAAGG - Intronic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
999227893 5:150042422-150042444 TAGAGGGCAGTGAGGGGGGAAGG + Intronic
999450209 5:151672207-151672229 AGGTGGGCGTGGAGGCGGGAAGG + Intronic
999451963 5:151685319-151685341 TAGAGGGCATGACGTGGGGATGG - Intronic
999542944 5:152593939-152593961 AATTGGGGATGGAGGGGGGATGG - Intergenic
999750331 5:154623845-154623867 AAGTGGGCATGGTGGGGTGGGGG - Intergenic
1000441632 5:161270737-161270759 TGGTGGGCATGGAGAGAGGGGGG + Intergenic
1000921974 5:167149159-167149181 TAGGGTGGGTGGAGGGGGGAGGG - Intergenic
1000942483 5:167379044-167379066 GGGTGGACATGGAGAGGGGAGGG - Intronic
1001040910 5:168334542-168334564 AAATGGGGGTGGAGGGGGGAGGG - Intronic
1001331603 5:170766464-170766486 AAGGGGGAATGGAGGGTGGAAGG + Intronic
1001933145 5:175687180-175687202 TTGAGGGCATGGAGGGCGGAGGG + Intergenic
1002475387 5:179462185-179462207 GTGTGGGCGTGGTGGGGGGAGGG - Intergenic
1003366629 6:5481278-5481300 TAATAGGCAGGGAAGGGGGAGGG + Intronic
1003469733 6:6418051-6418073 TAGTGGGAGTGGTGGGTGGAGGG - Intergenic
1004031596 6:11875488-11875510 TTGTGGGCTTGGAGGGAGGGCGG - Intergenic
1004204081 6:13574959-13574981 CAGTGGGCGTGGAGAGGGGTCGG + Intronic
1005014806 6:21365943-21365965 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1005480788 6:26253430-26253452 TAGTGGACAGGGAGGAGGGGTGG + Intergenic
1006102334 6:31693272-31693294 GAGAGGGCATGGAGGTGGGAGGG + Intronic
1006378603 6:33685081-33685103 GAGTGGGCATGATGGGGGCAGGG + Intronic
1006384727 6:33723981-33724003 CAGTGGGCATGGCCGGGGGGGGG + Intronic
1006385531 6:33728749-33728771 CAGAGGGCACGGAGGAGGGATGG - Intronic
1006995497 6:38256092-38256114 TGGTGGGCATGGCGGGGTGGGGG + Intronic
1007547703 6:42706988-42707010 TTTTTGGCATGGATGGGGGATGG + Intronic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1008219883 6:48842833-48842855 TAATGAGCATGGGGTGGGGAGGG + Intergenic
1009249201 6:61276983-61277005 TAGTGGGCCTGGTGGTAGGAAGG + Intergenic
1012992235 6:105938022-105938044 TAGAGGGCATGAAGCGGGGTTGG - Intergenic
1013461107 6:110376371-110376393 TAGTGGCAGTGGAGAGGGGAAGG + Intergenic
1013678988 6:112501860-112501882 AAGTGGAAATGGAGGGGGAAGGG - Intergenic
1013808285 6:114017150-114017172 AAGTAGGAATGGAGGGTGGAAGG + Intergenic
1014343228 6:120234062-120234084 TAGTGGGCATGCAGATGGGTAGG - Intergenic
1014561485 6:122896240-122896262 TTGTGGGGCTGGAGTGGGGAAGG + Intergenic
1014913307 6:127118605-127118627 AGGAGGGCAGGGAGGGGGGAGGG - Exonic
1015179304 6:130344929-130344951 TAGAGGAGATGGAGGGGGGTGGG - Intronic
1015722071 6:136252920-136252942 TATTGGGGGTTGAGGGGGGACGG + Intergenic
1015743243 6:136481629-136481651 TGGTGGGGATGGAGGGAGTAGGG + Intronic
1017715844 6:157212421-157212443 TGGTGGGGCTGGAGGTGGGAGGG + Intergenic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018283680 6:162215102-162215124 TAGTGGGCATTTAGGGGGAGGGG - Intronic
1018699632 6:166416289-166416311 TAGAGGTGATGGAGGAGGGATGG - Intronic
1018799261 6:167210045-167210067 TCCTGGGCATGGTGGGAGGAAGG - Intergenic
1019562183 7:1664671-1664693 AAGAGGGCAGGGAGAGGGGAGGG - Intergenic
1022051485 7:26678237-26678259 TAGTGGGCAGGGAGTGGGGGAGG - Intronic
1022447258 7:30480499-30480521 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023265275 7:38398551-38398573 TAGTGAGGAAGTAGGGGGGATGG + Intronic
1023279592 7:38555965-38555987 TTGTGGGGAAGGAGGAGGGAAGG + Intronic
1023327183 7:39073169-39073191 TAGTTTGCATGGATTGGGGATGG - Intronic
1024543647 7:50499685-50499707 TGGTGGGGATGGAGTGGGGCAGG - Intronic
1025065682 7:55853535-55853557 TAGTGGGGGTGGTGAGGGGATGG + Intronic
1025120908 7:56301340-56301362 TTGTGGGGATGAAGGTGGGATGG - Intergenic
1026019776 7:66697954-66697976 TAGTGGGGATGGAGAGGGCCGGG - Intronic
1026094720 7:67335742-67335764 TAGGGGGTCGGGAGGGGGGAGGG + Intergenic
1026145236 7:67740872-67740894 TGGTTGGCAGGGAGGGGGGATGG - Intergenic
1027053151 7:75032219-75032241 GAGTGGGGACGGTGGGGGGAAGG + Intronic
1027354263 7:77340924-77340946 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1027437150 7:78176040-78176062 TAGAGGGCAGGGAGGCTGGAGGG + Intronic
1027836502 7:83250870-83250892 TAGTGGGTGGGGATGGGGGAGGG - Intergenic
1028154568 7:87415207-87415229 TACTGGGCAGGGAGTGGGGAGGG - Intronic
1028486376 7:91362395-91362417 TCGGGGGCAGGGAGTGGGGAGGG + Intergenic
1029047298 7:97643899-97643921 CAATGGGCATGGAGGGGGGAAGG + Intergenic
1030841763 7:114362066-114362088 TGGTGGCCAGGGAGGGGGTAAGG + Intronic
1030988003 7:116264677-116264699 AAATGGGCATGGGGAGGGGAAGG + Intergenic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1032730770 7:134640808-134640830 TAAGGGGCAGGGAGTGGGGAAGG + Intergenic
1033168072 7:139058507-139058529 TGGTGGGGAGGGAGGGGGAAGGG + Intronic
1033518180 7:142130566-142130588 TAGTAGGCGTGGAGTGGGGTAGG - Intronic
1034530508 7:151693413-151693435 TGATGGGCCTGGAGGAGGGACGG - Intronic
1034757391 7:153635534-153635556 GAGGGGGGAGGGAGGGGGGAGGG - Intergenic
1034988152 7:155530420-155530442 CAGGGGTCATGGAGGGGAGAGGG - Intronic
1035035798 7:155892985-155893007 TAGTGGTGATGGAGAGGGCAAGG + Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1036472491 8:9063909-9063931 AAGGGGGAATGGAGGGTGGAAGG + Intronic
1036600453 8:10255915-10255937 TAGCGGGCATGGTGGGGGGATGG - Intronic
1037067894 8:14605543-14605565 TAGTGGGCATGGAGGGGCTTGGG - Intronic
1037164521 8:15810636-15810658 TTGTGGCCAAGGAGGGGGGGCGG + Intergenic
1037261962 8:17019630-17019652 TGGTGGGCGTGGGGTGGGGAGGG - Intergenic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1037818061 8:22122302-22122324 TCCAGGGCATGGAGGTGGGAGGG + Intronic
1037947555 8:22999049-22999071 TAAGGGCCATGGAGGGAGGAAGG + Intronic
1038015593 8:23511781-23511803 TATGGGGCATAGAGAGGGGAGGG - Intergenic
1038445045 8:27597911-27597933 TGGGGGGCAGGCAGGGGGGATGG - Exonic
1038446709 8:27609674-27609696 AAGTGGGCACGGCGGGGGGCTGG - Intronic
1038911242 8:31967256-31967278 AAGAGGGCGTGGAGGAGGGAGGG - Intronic
1039803673 8:40981253-40981275 CCGTGGGCAGGGAGGAGGGATGG + Intergenic
1040879380 8:52189116-52189138 TTGGGGGCAAGGAGGGGAGATGG - Intronic
1041093694 8:54328493-54328515 TAGTTTCCATGGTGGGGGGAGGG - Intergenic
1041423242 8:57692819-57692841 CAGAGGTCATGGAGGGGAGAGGG + Intergenic
1041648091 8:60274247-60274269 TAGTGAGAATTGAGGAGGGAGGG - Intronic
1041718135 8:60950606-60950628 CAGTGGGCAGGGAAGTGGGAGGG + Intergenic
1041765953 8:61418459-61418481 GAGTGGTAATGGAGGGGGTAAGG - Intronic
1042523020 8:69734248-69734270 TAGTGGCAAAGGAGGGTGGAGGG - Intronic
1043414086 8:80030557-80030579 TGGCGGCCATGTAGGGGGGACGG - Intronic
1044085126 8:87934639-87934661 TTGTGGGCATGGGGGTGGGGTGG + Intergenic
1044308565 8:90666168-90666190 TGCTGGGCATGGAGCGGAGACGG + Intronic
1044370343 8:91402899-91402921 GAGGGGGAATGGATGGGGGAGGG + Intergenic
1044419108 8:91971021-91971043 TAGTGGGCATGGTGGCTGGAAGG - Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045496323 8:102712491-102712513 TAGTGGGGATGGTGGGCGGGGGG - Intergenic
1045625932 8:104050400-104050422 TAGTGGGATTGGGGTGGGGAAGG + Intronic
1046242252 8:111511467-111511489 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
1047463948 8:125094133-125094155 TATTGGGTATGAAGGGGAGAAGG + Intronic
1047551567 8:125878487-125878509 TAGTGGAGAGGGAGAGGGGAGGG + Intergenic
1047594660 8:126366234-126366256 TTGTGGGGAAGAAGGGGGGAAGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1049217765 8:141415674-141415696 TAGGGGGCGTGGCGGGGAGAGGG + Intronic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1049894070 9:97604-97626 TAGTGGGCATGGAAGGGAGGGGG - Intergenic
1050977300 9:11956343-11956365 GAAGGGGCATGGTGGGGGGAAGG + Intergenic
1052099543 9:24428254-24428276 TACTGGGATTGGAGGGGGTATGG + Intergenic
1052228274 9:26116314-26116336 TTGTGGGCGTGGCAGGGGGAGGG + Intronic
1052314181 9:27098836-27098858 CAGCGGGCAAGGAGGTGGGATGG - Intergenic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1052997257 9:34557792-34557814 CAGAGGGCATGGTGGTGGGATGG + Intronic
1053060119 9:35024099-35024121 AAGGGGGAATGGAGGGCGGAAGG + Intergenic
1053405424 9:37871187-37871209 TATTGGGGAAGGTGGGGGGAGGG + Intronic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1053735296 9:41097688-41097710 TAGTGGGCATGGAAGGGAGGGGG - Intergenic
1054693083 9:68333709-68333731 TAGTGGGCATGGAAGGGAGGGGG + Intronic
1054696667 9:68367299-68367321 GGGTGGGCATGAAGGGGAGAGGG - Intronic
1055471627 9:76617684-76617706 GGCTGGGCATGGAGGAGGGAGGG - Intronic
1055997834 9:82180958-82180980 TAGTGGGGACTGAGGGGGCAGGG + Intergenic
1056136269 9:83632189-83632211 GAGTGGGAATGGCGGGGAGATGG - Intronic
1056391725 9:86147034-86147056 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1056748356 9:89324996-89325018 TGGTGGGCTTGGAGCAGGGAAGG + Intronic
1056782344 9:89560270-89560292 TAGTGGGCAGGGAAGGGAGCTGG + Intergenic
1056838130 9:89974454-89974476 AGATGGGCATGGAGGGGGAAGGG + Intergenic
1057717178 9:97503857-97503879 TAGTGGACCTGGAGTGGAGAGGG + Intronic
1057935932 9:99238954-99238976 TGGTGGGCAGAGCGGGGGGAGGG - Intergenic
1057937721 9:99254725-99254747 TAGTTGCCATGGGGTGGGGAGGG - Intergenic
1059163476 9:112057128-112057150 TGGTGGGGATGGAGTGGGGAGGG - Intronic
1059555749 9:115278373-115278395 TAGTTAGCACGGAGGGGGCAGGG - Intronic
1059845114 9:118266976-118266998 TAGTGGGCAAGTAGAGGGGTTGG + Intergenic
1060295569 9:122340786-122340808 TGGTGGGGATGGAGGTGGGGTGG + Intergenic
1060824338 9:126679388-126679410 GAGGGTGGATGGAGGGGGGATGG + Intronic
1061306573 9:129736131-129736153 GAGTGGGGATGGGGGAGGGATGG - Intergenic
1061378567 9:130240616-130240638 CAGTGGGCATGGAAAGGGGCTGG + Intergenic
1061509490 9:131051821-131051843 TACTGGGAAAGGAGGAGGGAGGG + Intronic
1061625606 9:131839071-131839093 GAGAGGGCAGGGAGAGGGGAGGG + Intergenic
1061839191 9:133347881-133347903 GGGTGGGGATGGAGGGGGGGTGG - Intronic
1061942547 9:133891398-133891420 GAGGGGAGATGGAGGGGGGATGG + Intronic
1061942553 9:133891409-133891431 GAGGGGGGATGGAGGGGGGACGG + Intronic
1062194207 9:135264057-135264079 GAGAGGGCAGGGAGGGGGTAAGG - Intergenic
1062399798 9:136367375-136367397 TTCTGGGCATGGAGGGGGCCTGG - Intronic
1062543845 9:137053238-137053260 TATTGGGCTTGTAGGGGGGTGGG - Intronic
1185511569 X:668097-668119 GAGTGGGAAAGGAGAGGGGAGGG - Intergenic
1186157147 X:6737580-6737602 GAGTGGCCATGGATGAGGGAGGG + Intergenic
1186367180 X:8907789-8907811 TTGTTGGCATGGGGTGGGGATGG - Intergenic
1186801090 X:13092929-13092951 CAGTGGGCAGTGAGGGGGCAGGG + Intergenic
1186976348 X:14910245-14910267 CAGTGGGCATGGACCTGGGAAGG - Intronic
1187024210 X:15417057-15417079 TACTGGGGGTGGAGGGGGGCGGG - Intronic
1187043015 X:15616841-15616863 GAGTGGGCATGGTGGAGGGGCGG - Intergenic
1187286307 X:17907168-17907190 AAGTGGGAGTGGAGGGGTGAGGG - Intergenic
1188000981 X:24981348-24981370 TATTGGGGCTGGAGGGGGGAAGG - Intronic
1188430873 X:30104600-30104622 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1189485779 X:41430646-41430668 TGGTGGGAATGGAGGGTGGGGGG - Intergenic
1189689986 X:43606663-43606685 TGGTGGGGAGGGAGGTGGGATGG - Intergenic
1190287501 X:48971059-48971081 TAGTAGGGCTGGAGAGGGGAAGG + Exonic
1190339558 X:49286076-49286098 GAGTGAGAATGGAGGGGGGCTGG + Exonic
1191735105 X:64380735-64380757 TAGGGTGGAAGGAGGGGGGAGGG - Intronic
1191786873 X:64925635-64925657 AAGTAGGCATGGAGGGAGGAGGG - Intronic
1191805962 X:65134117-65134139 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1192207077 X:69103478-69103500 GAGTGGGGGTGGAGGTGGGATGG - Intergenic
1192525325 X:71838073-71838095 TTGTGGGGTGGGAGGGGGGAGGG - Intergenic
1192821726 X:74653407-74653429 AAGTGGGCAAAGCGGGGGGACGG - Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1194213295 X:91096124-91096146 TACTGGGCATTGAGTGGAGATGG - Intergenic
1195017104 X:100790900-100790922 AAGAGGGAATGGAGGGTGGAAGG + Intergenic
1195766601 X:108302989-108303011 TTGGGGGGGTGGAGGGGGGAGGG - Intronic
1196401636 X:115323234-115323256 TAGTGTGCAGGGTGGGAGGAGGG + Intergenic
1197284501 X:124580551-124580573 TAGTGGTTATGGAGTGGGGTTGG + Intronic
1197470811 X:126864352-126864374 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1197668280 X:129246839-129246861 TGGTGGGGGGGGAGGGGGGAGGG + Intergenic
1197976847 X:132174865-132174887 GAGTGGGCATAGAAGGGAGATGG + Intergenic
1197986716 X:132273840-132273862 TAATGGGTATGGGGGGTGGATGG - Intergenic
1198033287 X:132776574-132776596 GAGTGAGGATGGATGGGGGAAGG - Intronic
1198093881 X:133359011-133359033 TATGAGGGATGGAGGGGGGAAGG + Intronic
1198683190 X:139203525-139203547 TGGTGGGAAAGGAGGGGGGAGGG + Intronic
1199915087 X:152330699-152330721 TGGGGTGCAGGGAGGGGGGAGGG + Intronic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1200229845 X:154438401-154438423 CAGTGGGGATGGTGGGTGGAAGG + Intronic
1200826471 Y:7649989-7650011 TAGTGGGAGTGGGGGTGGGAGGG + Intergenic
1200828095 Y:7663673-7663695 GAGTGGGGATGGAGTGGGGAGGG + Intergenic
1201743947 Y:17350869-17350891 TAGTGGACATGGATGGAGGGGGG + Intergenic
1202233428 Y:22679866-22679888 TAGTGGGAGTGGGGGTGGGAGGG - Intergenic
1202309728 Y:23516292-23516314 TAGTGGGAGTGGGGGTGGGAGGG + Intergenic
1202561073 Y:26154301-26154323 TAGTGGGAGTGGGGGTGGGAGGG - Intergenic