ID: 1087716296

View in Genome Browser
Species Human (GRCh38)
Location 11:101612619-101612641
Sequence CAGGGTCACCCATCGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087716296_1087716302 16 Left 1087716296 11:101612619-101612641 CCAACTTCCGATGGGTGACCCTG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1087716302 11:101612658-101612680 TCCCCAGTCCCTCCAGCCTAAGG 0: 1
1: 0
2: 9
3: 45
4: 433
1087716296_1087716306 20 Left 1087716296 11:101612619-101612641 CCAACTTCCGATGGGTGACCCTG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1087716306 11:101612662-101612684 CAGTCCCTCCAGCCTAAGGATGG 0: 1
1: 0
2: 0
3: 24
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087716296 Original CRISPR CAGGGTCACCCATCGGAAGT TGG (reversed) Intronic
904556620 1:31369076-31369098 CAGGGTCACCCAGCTGGAGCTGG + Intronic
905914419 1:41675047-41675069 CAGGGACACCCATGGGAGGATGG - Intronic
918310789 1:183283862-183283884 CAGGGTCTCCTCTCGGAAGAGGG - Intronic
1070528486 10:77315753-77315775 CAGTGCCACCCATTGGCAGTGGG + Intronic
1074100114 10:110348232-110348254 CAGGGTCACCCATCAGGGGCTGG - Intergenic
1076274094 10:129181999-129182021 CAGGGTCTACCTTCAGAAGTTGG - Intergenic
1078670823 11:13363767-13363789 CAGGGTCACTCTTGGGAAGATGG - Intronic
1080700497 11:34640171-34640193 CAGGGTCACCCACAGTAAGCAGG + Intronic
1081782729 11:45724342-45724364 CAGGGTAACCCATCTGTAGTAGG - Intergenic
1082794907 11:57371689-57371711 CAGGGTCAGCCTTGGGAATTGGG + Intergenic
1084644777 11:70449588-70449610 CAGGGTCACTCAGAGGAAGGAGG + Intergenic
1084680908 11:70665855-70665877 CAGGGTCACCCAGCTCAAGAAGG - Intronic
1084714378 11:70864352-70864374 CAGGGTCACCTGTCCGAAGCTGG - Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1089333842 11:117709146-117709168 CAGGGTCACACATTGAAACTAGG - Intronic
1090575613 11:128099592-128099614 CATGGTCATCTATGGGAAGTGGG + Intergenic
1112862500 13:103849923-103849945 CAGGGCGAACCATGGGAAGTGGG + Intergenic
1113552658 13:111205072-111205094 CAGGGTCCCCCCTCGGCATTAGG - Intronic
1113562128 13:111289971-111289993 CTGGGTAACCCATCAGAAGGTGG + Intronic
1113721285 13:112559549-112559571 CAGTGCCACCCATCCGAAGGCGG + Intronic
1117304830 14:54463111-54463133 CAAGGTCTCCCATAGGAAGCTGG + Intergenic
1121553886 14:94821982-94822004 CAAGGTCACACAGCAGAAGTGGG - Intergenic
1130737799 15:86568821-86568843 AAGGGTCAAGCATAGGAAGTTGG + Intronic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1133042027 16:3065932-3065954 CAGGGGCACCCAGCGGCAGGAGG + Intronic
1136004498 16:27319367-27319389 CAGGGTCACACACCTGAAGGTGG + Intronic
1136545065 16:30949931-30949953 AAGGGTCACCCAGCTGAAGGTGG + Intronic
1137928831 16:52567250-52567272 CAGGGTGTCCCATCCTAAGTGGG + Intergenic
1139375588 16:66494519-66494541 CAGGGTCACACAACTGAACTGGG - Intronic
1139613085 16:68072787-68072809 CTGGGACACCCAGTGGAAGTCGG - Intronic
1140231951 16:73124629-73124651 CAGGGTCACACATCTGTATTAGG + Intergenic
1140551359 16:75869692-75869714 CAGGGTCACCCAGGGCAGGTTGG + Intergenic
1142355773 16:89601122-89601144 CAGGGTCACACAGCGGGAGCTGG - Intergenic
1146178961 17:30685157-30685179 CAGGGTGACCCTTCTGAAGGGGG + Intergenic
1160445304 18:78922846-78922868 CAGGGTCACCCGTCAGCAGAGGG + Intergenic
1160783901 19:891027-891049 CAGGGGCACCGATGGGCAGTGGG + Exonic
1160897479 19:1409401-1409423 CATGGACACCCTTGGGAAGTGGG + Intronic
1162979652 19:14230397-14230419 CAGGGTGACCCTTCTGAAGGGGG - Intergenic
1163804615 19:19387890-19387912 CAGTGTCTCCCATCGGGAGACGG - Intronic
1167239322 19:48333907-48333929 CAGGTTCACCCGTGGGAACTGGG + Intronic
926120245 2:10237804-10237826 CAAGGTCACCCATCTGGTGTTGG + Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
930774552 2:55159304-55159326 CAGGGCCACACATGGGAAGCAGG - Intergenic
939635171 2:144573342-144573364 CAGGGTCACCAATAGGAGCTAGG + Intergenic
941964643 2:171288960-171288982 CAGGCACACCCATCGTAAGCGGG + Intergenic
942884439 2:180906015-180906037 CAGGGTCATCCCCAGGAAGTTGG - Intergenic
947712074 2:232321981-232322003 CAGGGTCACCCATCTGAACCTGG - Intronic
947731315 2:232433100-232433122 CAGGGTCACCCATCTGAACCTGG - Intergenic
1173113887 20:40222012-40222034 CAGAGTTACTCATAGGAAGTTGG - Intergenic
1173374906 20:42474561-42474583 CAGGGTCACCCATTTGATTTGGG - Intronic
1176241193 20:64076710-64076732 CAGGGCTACCCATGGGAAGGTGG - Intronic
1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG + Intronic
1184217270 22:43076055-43076077 CCCACTCACCCATCGGAAGTCGG - Intronic
949233041 3:1773976-1773998 CTGGGGCAGCCATTGGAAGTTGG - Intergenic
949473552 3:4420913-4420935 CAGGGTCACCCAGCTAATGTTGG - Intronic
951285580 3:20809154-20809176 GTGGGTCACCCATTGGAAGCTGG + Intergenic
952694440 3:36249351-36249373 CAGGGGCACACATCAGAAGGAGG + Intergenic
955750465 3:62181213-62181235 CAGGGTCCCACATCGGAAGAAGG + Intronic
965459085 3:168939485-168939507 CAGGTTGAACCATCGTAAGTTGG - Intergenic
967118987 3:186365934-186365956 CAGGGTCACCAACCGCAAGGTGG + Intergenic
973086586 4:46070153-46070175 CAGGGTCAATCATTGGAAATTGG - Intronic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
997475143 5:134138388-134138410 CGGGGTCACCCATGGGATTTAGG - Intronic
998065761 5:139157020-139157042 CAGGGTCACCCATCAGATAGTGG - Intronic
1000409612 5:160924301-160924323 CAGGGGCACCCAGCTGAAGGTGG - Intergenic
1005117122 6:22351342-22351364 CATGGTCACCCATCTGAGGAGGG + Intergenic
1005583214 6:27252092-27252114 CAAGATCACACAACGGAAGTGGG - Intronic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1017014163 6:150086402-150086424 CAGGGTCACCCAGCAATAGTGGG - Intergenic
1017907939 6:158769601-158769623 CAGGGTCACCCATTGAAGGTGGG - Intronic
1022214289 7:28243108-28243130 CAAGGTCACTCATAGGAAGGTGG + Intergenic
1043350094 8:79349996-79350018 TTGGGTCCCCCATAGGAAGTGGG + Intergenic
1045224796 8:100233926-100233948 ATGGGTGACCCAGCGGAAGTTGG + Intronic
1045886891 8:107108703-107108725 CAGGGAGACCCAGCGGAAGGTGG - Intergenic
1049569023 8:143359789-143359811 CTGGGTCACCCACAGGAAGAGGG + Intronic
1053561068 9:39194621-39194643 CAGGGACACCCATTGGTGGTTGG - Intronic
1053825166 9:42014866-42014888 CAGGGACACCCATTGGTGGTTGG - Intronic
1054136051 9:61424336-61424358 CAGGGACACCCATTGGTGGTTGG + Intergenic
1054605401 9:67172495-67172517 CAGGGACACCCATTGGTGGTTGG + Intergenic
1054810286 9:69428802-69428824 CAGGTCCACCCAGCTGAAGTGGG - Exonic
1059290621 9:113221078-113221100 AAGGGTCTCCCCCCGGAAGTTGG + Intronic
1061154084 9:128846675-128846697 CAGGGTCACCCAGCCAAGGTGGG - Intronic
1061712615 9:132498491-132498513 CAGGGTCACACAGCAGAAGCGGG - Intronic
1195976736 X:110535220-110535242 CAGGTGCAGCCATAGGAAGTAGG - Intergenic
1200796533 Y:7346115-7346137 CAGGGACACCCATAGGCAGGGGG - Intergenic