ID: 1087716302

View in Genome Browser
Species Human (GRCh38)
Location 11:101612658-101612680
Sequence TCCCCAGTCCCTCCAGCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 9, 3: 45, 4: 433}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087716293_1087716302 27 Left 1087716293 11:101612608-101612630 CCACTGTGGTTCCAACTTCCGAT 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1087716302 11:101612658-101612680 TCCCCAGTCCCTCCAGCCTAAGG 0: 1
1: 0
2: 9
3: 45
4: 433
1087716296_1087716302 16 Left 1087716296 11:101612619-101612641 CCAACTTCCGATGGGTGACCCTG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1087716302 11:101612658-101612680 TCCCCAGTCCCTCCAGCCTAAGG 0: 1
1: 0
2: 9
3: 45
4: 433
1087716299_1087716302 -3 Left 1087716299 11:101612638-101612660 CCTGCTTATAACCCAGATCTTCC 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1087716302 11:101612658-101612680 TCCCCAGTCCCTCCAGCCTAAGG 0: 1
1: 0
2: 9
3: 45
4: 433
1087716297_1087716302 9 Left 1087716297 11:101612626-101612648 CCGATGGGTGACCCTGCTTATAA 0: 1
1: 0
2: 1
3: 11
4: 93
Right 1087716302 11:101612658-101612680 TCCCCAGTCCCTCCAGCCTAAGG 0: 1
1: 0
2: 9
3: 45
4: 433
1087716298_1087716302 -2 Left 1087716298 11:101612637-101612659 CCCTGCTTATAACCCAGATCTTC 0: 1
1: 0
2: 2
3: 24
4: 176
Right 1087716302 11:101612658-101612680 TCCCCAGTCCCTCCAGCCTAAGG 0: 1
1: 0
2: 9
3: 45
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087716302 Original CRISPR TCCCCAGTCCCTCCAGCCTA AGG Intronic
900515981 1:3082446-3082468 TCCCCAGACCCTGCAGGCTGAGG - Intronic
900892088 1:5456816-5456838 TCCCCTGTCTCTCCAGGCAAAGG + Intergenic
901005970 1:6171682-6171704 CCACCAGTCCCTCCTCCCTATGG + Intronic
901034025 1:6325573-6325595 TACCCAGTCCCACTGGCCTAAGG + Intronic
901159235 1:7162462-7162484 CCCCCAGCCCCTCCAGCCCAGGG + Intronic
902188929 1:14746993-14747015 TCCCTTGTCCCCCCAGCCTCTGG + Intronic
902409142 1:16202568-16202590 TCCCCCGGTCCTCCAGGCTAGGG - Exonic
902528538 1:17075644-17075666 ACCCCATTCACTCCAGCCTCGGG + Intronic
902960296 1:19958535-19958557 TCCCCAGTTGTTCAAGCCTAGGG + Intergenic
903668265 1:25021167-25021189 ACCCCAGGACCTACAGCCTACGG + Intergenic
903735481 1:25527713-25527735 TCCCTCCTCCCTCCAGCCTCTGG - Intergenic
904410146 1:30320194-30320216 CCCCCCGTCCCTCCATCCTTGGG - Intergenic
904576689 1:31509466-31509488 TCCCCAGGCCCTCTAGCCACTGG + Intergenic
905060806 1:35137490-35137512 TCCTCAGACCCACCAGCCCAAGG - Intergenic
905223732 1:36466365-36466387 TCCCCAGCGCCTCCATCCCATGG + Exonic
906665898 1:47621811-47621833 TCCACAGGCCCTGCAGCCTCAGG - Intergenic
907292347 1:53424868-53424890 TCCTCAGACCCACCAGCCCAAGG + Intergenic
907503866 1:54903063-54903085 TCCTCAGACCCACCAGCCCAAGG - Intergenic
907987991 1:59552074-59552096 TCCTTAGTCCCTCCAGCCTGGGG - Intronic
908011016 1:59777528-59777550 TCCTCTGTCCCTCTGGCCTAGGG - Intergenic
909158427 1:72112666-72112688 TTCCCCCTCCCTCCAGTCTAGGG - Intronic
910049080 1:82955824-82955846 TCCTCAGACCCGCCAGCCCAAGG + Intergenic
910848831 1:91631150-91631172 TCCCCAATCCCCCCAGCCCTAGG - Intergenic
911184150 1:94886606-94886628 TCCCCTCTCCCTCCAGCTTGTGG + Intronic
911808117 1:102236707-102236729 TGCCCAGTCTCTCAAGCATATGG + Intergenic
912296193 1:108473496-108473518 TCCTCAGACCCACCAGCCCAAGG + Intergenic
912753223 1:112302625-112302647 TGCTCAGTCCCTCCATCCTCAGG - Intergenic
913040103 1:115013727-115013749 TCCCTACTCTCTCCAGCCTCTGG + Intergenic
913455941 1:119030780-119030802 TCCCCTGGTTCTCCAGCCTAAGG + Intergenic
915530062 1:156498223-156498245 TGCCCAGGCCCTCCAGCCCAGGG + Intronic
916479758 1:165204316-165204338 TGCCCTGTCTCTCCAGCCTCTGG - Intronic
917455454 1:175182142-175182164 TCATCAGTCACTCCTGCCTATGG - Intronic
919133520 1:193480395-193480417 CCCCCACTCCTTGCAGCCTATGG - Intergenic
919730287 1:200909250-200909272 GGCCCAGTGCCTCCAGCCTGTGG + Exonic
920121554 1:203662466-203662488 TCCCCACTCCATCCAGCCTGTGG + Intronic
920179360 1:204122971-204122993 CCCCCACTCCCTTGAGCCTAGGG + Intronic
921509005 1:216008655-216008677 TCCTCAGACCCACCAGCCCAAGG + Intronic
922279847 1:224113540-224113562 TCCCCATTTCCCCCAGCCTCTGG + Intergenic
922724933 1:227918310-227918332 TCCCCAGGCCCTCCTCCCCAGGG + Intergenic
922934526 1:229412917-229412939 TCCTCAGACCCACCAGCCCAAGG + Intergenic
923678737 1:236102215-236102237 TCCCCTGTCCCTCCCGCCTGTGG + Intergenic
1064576900 10:16755750-16755772 TCCCCTCTCCCTCCAGCCTGTGG + Intronic
1065437344 10:25716935-25716957 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1066690789 10:38025933-38025955 TCCCCCCTCCTGCCAGCCTATGG + Intronic
1067001863 10:42622680-42622702 TTCCCATTCCCACCAGCCTGTGG - Intronic
1067001953 10:42623658-42623680 TCCCCCCTCCCAACAGCCTATGG - Intronic
1067013220 10:42733925-42733947 TTCCCTCTCCCTCCAGCCTCTGG - Intergenic
1067310614 10:45110178-45110200 TCCCCTCTCCCTCCAGCCTCTGG + Intergenic
1067659910 10:48226975-48226997 ACCCCACTCACTCCAGCCTATGG + Intronic
1068199015 10:53758665-53758687 TTCCCTCTCACTCCAGCCTATGG - Intergenic
1068592703 10:58866757-58866779 TCCTCAGACCCACCAGCCCAAGG - Intergenic
1068622833 10:59206146-59206168 ATCCTAGTCCCTCCAGCCTAAGG + Intronic
1069849135 10:71393778-71393800 TCCCTTATCCCTCCAGTCTAGGG + Intergenic
1070533786 10:77360414-77360436 TTCCCAGTCTTTCCAGGCTATGG + Intronic
1070778417 10:79123707-79123729 TCGCCAGCCCCTCCAGCCCCTGG + Intronic
1071299073 10:84243065-84243087 TCCCCAGTCCTTCATGCCTGTGG + Intergenic
1071373513 10:84977944-84977966 TCCCCACTCCCCCCACCCCATGG - Intergenic
1071396401 10:85228154-85228176 TCTCCAGTCCTTCCAGCTTCAGG - Intergenic
1071960801 10:90807839-90807861 TCCTCAGACCCACCAGCCCAAGG + Intronic
1072011592 10:91306798-91306820 TCCTCAGACCCACCAGCCCAAGG - Intergenic
1072306001 10:94107966-94107988 TCCACAGTCCATCCAGCCCACGG - Intronic
1072623825 10:97098418-97098440 TCCCAGGTCCCTCCAGCCAAGGG - Intronic
1074835085 10:117283999-117284021 TTTCCTGTCCTTCCAGCCTAAGG + Exonic
1075807456 10:125200384-125200406 TCCTCTGTCCCTCCAGCCCTAGG - Intergenic
1076375412 10:129980345-129980367 GCCCCAGTCCATCCTGCATAAGG + Intergenic
1076845995 10:133069773-133069795 CCCCCAGTCTCTGCACCCTACGG - Intergenic
1076915640 10:133422006-133422028 TTCCCAGTCCCGCCAGCCTGGGG - Exonic
1076990238 11:269195-269217 TCCTCCGTCCCCCCAGCCTCTGG + Intergenic
1077081328 11:725932-725954 GCCCCAGTCTCTCCAGCCGCGGG - Intronic
1077334174 11:1996165-1996187 GCCGCAGCCCCACCAGCCTAAGG + Intergenic
1077401986 11:2363457-2363479 TGCCCAGTCCCTCCAGCCTCTGG + Intergenic
1077531619 11:3099198-3099220 TCCTCAGTCCCTCCAGGCCCTGG - Intronic
1078966158 11:16346324-16346346 ACACCAGTCCACCCAGCCTAGGG + Intronic
1079308871 11:19347063-19347085 TCCCCAGTCCCGGCAGCCACTGG + Intergenic
1079418521 11:20263800-20263822 TCCCCACTGCCCCCAGCCTCTGG - Intergenic
1079727381 11:23892402-23892424 TCCTCAGACCCACCAGCCCAAGG - Intergenic
1080190996 11:29549223-29549245 TCCCCATTGCCTCCAGCCCCTGG + Intergenic
1080614304 11:33932824-33932846 CCCTCCCTCCCTCCAGCCTATGG + Intergenic
1081644277 11:44778891-44778913 TCCCCAGGACCTCCAGCCACTGG - Intronic
1082828381 11:57597876-57597898 ACCCCAGCCCCTCCCGCCTCAGG + Intronic
1083291941 11:61695423-61695445 TCCCCAGAAGCTCCTGCCTAAGG + Intronic
1083596043 11:63918667-63918689 TCCCCAGCACCTCCACCCTTTGG + Intergenic
1083987800 11:66228143-66228165 TCCCCTGTACCTCCGGCCCAGGG + Intronic
1084101591 11:66953210-66953232 TGCCCACTCCGTCCAGCCTCAGG + Intronic
1085101281 11:73802476-73802498 TCCCCAGCCCTTCCAGCCCCAGG + Intronic
1085278319 11:75314141-75314163 ACTCCAGTCCCACCAGCCTGGGG + Intronic
1085321272 11:75575490-75575512 TCCCCAGTCCCTGCAGCACGGGG + Intergenic
1085422554 11:76376040-76376062 TCCCCTGCCCTTCCAGCCTTTGG - Intronic
1086136562 11:83448062-83448084 TCCTCAGACCCACCAGCCCAAGG - Intergenic
1086320339 11:85640039-85640061 TCCCCATTTCCCCCAGCCTTTGG - Intergenic
1086445411 11:86865932-86865954 TGCCCAGTCTCTCAGGCCTATGG - Intronic
1087716302 11:101612658-101612680 TCCCCAGTCCCTCCAGCCTAAGG + Intronic
1089232063 11:116986950-116986972 TTCCCCTTCCCTCCAGCCTCTGG - Intronic
1089952967 11:122547127-122547149 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1090863129 11:130672289-130672311 TCCCCAGGCCCTGAAGCCCAAGG - Intergenic
1090927245 11:131259744-131259766 TCCTCAGACCCACCAGCCCAAGG - Intergenic
1091181185 11:133605940-133605962 TTCCCAGTCCCTCAAGTCTTTGG - Intergenic
1091183362 11:133627287-133627309 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1091322768 11:134663677-134663699 ACCCCAGTCTCTCCAGACTTTGG - Intergenic
1202817157 11_KI270721v1_random:51347-51369 GCCGCAGCCCCACCAGCCTAAGG + Intergenic
1092767559 12:11866977-11866999 TCCCCAGTCCGTGCAGCACAGGG - Intronic
1093767446 12:22981418-22981440 TTCCCAGTCCATCCAGTCCATGG - Intergenic
1094825473 12:34266144-34266166 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1096098076 12:48950674-48950696 CCCCCTGTCCCTCCAGCCCCTGG + Intronic
1097094729 12:56537350-56537372 TCTCCTCTCCCTCCAGCCTCTGG + Intronic
1097261044 12:57720432-57720454 TCTTCAGTCCCTTCAGCCCATGG - Exonic
1097542472 12:60957092-60957114 TCCTCAGACCCACCAGCCCAAGG - Intergenic
1097724237 12:63056478-63056500 TCCGCAGTCCCTCCAGCCCCTGG + Intergenic
1097777841 12:63668698-63668720 TCCCCAGCGCCTGCAGCCTCCGG + Intronic
1098628763 12:72703774-72703796 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1101605199 12:106243116-106243138 CACCCAGTCCCCCCACCCTAGGG - Intronic
1102529173 12:113533321-113533343 CACCCCGTCCCTCCAGCCTAGGG + Intergenic
1103034600 12:117646547-117646569 TCCCCAAACCCTCCAGGCTTTGG - Intronic
1104011006 12:124929973-124929995 TCTCAAGCCCCGCCAGCCTATGG + Intergenic
1104253860 12:127123357-127123379 TCCCCAGTCCCTCCACACATTGG + Intergenic
1104379899 12:128298252-128298274 TCCCCAGGCTCTCCAGCCTCAGG + Intronic
1104543439 12:129688093-129688115 TCCCCAGTGGCTCCAGCTCAAGG - Intronic
1104579805 12:130002896-130002918 TCCCCAGCCCTTTCAGCCTGGGG + Intergenic
1104838315 12:131807049-131807071 TCCCCAATCCCCCCAGCCCTAGG - Intergenic
1105205687 13:18221606-18221628 TCCCCAGTCCTCCTAGCCCAAGG - Intergenic
1105860769 13:24410242-24410264 TCCACAGTCCCCCCAGCCCCCGG + Intergenic
1106980009 13:35268337-35268359 TCCCCACTCCCTGCAGCCCCTGG - Intronic
1107948310 13:45439535-45439557 TCCCCATTTCCTCCATCCTCTGG - Intergenic
1108202386 13:48056865-48056887 TCCTCAGACCCACCAGCCCAAGG + Intronic
1108236091 13:48406982-48407004 TCCTCAGTTTCCCCAGCCTAAGG + Intronic
1109352790 13:61206185-61206207 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1111398967 13:87706976-87706998 TTCCCACTCCCTCCAGCCTGTGG + Intergenic
1112889621 13:104213298-104213320 TCCTCAGACCCACCAGCCCAAGG - Intergenic
1113827475 13:113267929-113267951 CCCCCCCACCCTCCAGCCTAGGG - Intergenic
1114654783 14:24309715-24309737 GCCCCAGTCACTCCACCCTCAGG - Intronic
1116883581 14:50196139-50196161 TCCCCCTTCCCTTCAGCCTCTGG - Intronic
1117199223 14:53371261-53371283 TCCCCACTCCATCCAGCTAAAGG - Intergenic
1120017889 14:79495141-79495163 TACCCTGGCCCTCCAGCCTCAGG - Intronic
1120660266 14:87240259-87240281 TCCTCAGACCCACCAGCCCAAGG - Intergenic
1121247136 14:92469894-92469916 TCCTCATTTCCTCCAGCCTCTGG - Intronic
1122886949 14:104714432-104714454 TCCCCAGTGCCCCCAGCCCTTGG + Exonic
1123449558 15:20351329-20351351 CCCCCTGTCCCTCCAGCCCACGG - Intergenic
1124049087 15:26178490-26178512 CCCTCCGTCCCCCCAGCCTATGG - Intergenic
1124413633 15:29457083-29457105 TCCCCAGTGGCTCCAGCAGAAGG + Intronic
1124644422 15:31426951-31426973 ACTCCAGTCTCTCCAGCCTTTGG + Intronic
1125325634 15:38533674-38533696 TCCCCAGCCCCTCAAGACTCAGG + Intronic
1125899112 15:43329156-43329178 TCCCCAGTAAGTCCAGCCTTGGG - Exonic
1126199229 15:45966923-45966945 TCCTACATCCCTCCAGCCTACGG - Intergenic
1126281598 15:46958018-46958040 TCCCTCCTCCCTCCAGCCTATGG + Intergenic
1126870201 15:52979150-52979172 TTCCCAGTCCCTGCAGACTTGGG + Intergenic
1126945496 15:53814567-53814589 TTCCCACTCCCGCCAGCCTCTGG + Intergenic
1130691787 15:86087930-86087952 TGGCCAGTCCTTCCAGCCTGTGG - Intergenic
1130693525 15:86106964-86106986 TCAACAATCCCTCCAGCCTCAGG - Intergenic
1130993996 15:88894308-88894330 TTCCCAGGCGCCCCAGCCTAGGG + Intronic
1131447403 15:92511871-92511893 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1132657704 16:1048286-1048308 GCCCCAGGCCCCCCAACCTAGGG - Intergenic
1132756705 16:1488765-1488787 TTGCCTGTTCCTCCAGCCTACGG + Intronic
1132786144 16:1657960-1657982 TCCCGAGTCCCCCCAGCACAGGG - Intronic
1132983717 16:2752764-2752786 TCCCGAGTCCCTCGGGCCTGGGG - Exonic
1133651106 16:7815196-7815218 TCCTCAGACCCACCAGCCGAAGG + Intergenic
1133695548 16:8259267-8259289 TCCCCACTCCCTCCAGCTCCTGG + Intergenic
1134453600 16:14378498-14378520 TCCCCAGCTCCTCCCACCTAGGG - Intergenic
1134733958 16:16485033-16485055 TTCCCAGTCTCTCCCTCCTAAGG + Intergenic
1134933542 16:18227249-18227271 TTCCCAGTCTCTCCCTCCTAAGG - Intergenic
1135350376 16:21724285-21724307 TCCCCTGTCTCTCCAGTCTATGG - Intronic
1135607595 16:23836939-23836961 TCCCCAGTCCCTCCAGTAGTGGG + Intronic
1135637595 16:24092175-24092197 TTCCCTTTCCCTCCAGCCTCTGG + Intronic
1136366605 16:29811981-29812003 TCCCCGGCCCCTCCCGCCAACGG - Intronic
1136409098 16:30066062-30066084 TCCCCGGCCCCTCCAGCCTGAGG + Intronic
1137289321 16:47041208-47041230 TTCCCAGCCCCTCCAGCCTCAGG + Intergenic
1137394400 16:48106626-48106648 TCCCCAGTGCCACCACCCTTTGG + Intronic
1137976181 16:53034033-53034055 TCCCCACTCCCTCCACACCATGG - Intergenic
1138611480 16:58128879-58128901 GCCCCAGTCCCGCCAGGCTGGGG + Intronic
1138634537 16:58326819-58326841 TCCCTCCTCCCTCCAGCCTCTGG - Intronic
1138759322 16:59522405-59522427 TCCTCAGACCCACCAGCCCAAGG - Intergenic
1139611450 16:68061791-68061813 TCCCAAGTCGCTCTAGCCTCTGG - Intronic
1140486247 16:75295979-75296001 ACCCCAGCCCCACCAGCCCAAGG + Intronic
1141225129 16:82107792-82107814 TTCCCAGGCCCTCCATGCTAGGG - Intergenic
1141421197 16:83917693-83917715 TCCCCAGACCCTCAGGCCTGCGG + Exonic
1141539567 16:84709326-84709348 TCCAAATTCCCTCCAGCCAAAGG - Intronic
1141929752 16:87194251-87194273 TCCCCAGTCCCCCCAGGCCGAGG - Intronic
1142306169 16:89287155-89287177 TCCCCAGTCCCAGCTGCTTAGGG + Intronic
1142434176 16:90046729-90046751 TCCTCCCTCCCTCCAGCCTCAGG - Intergenic
1142718627 17:1762164-1762186 TCCCCTGTCCCCCCAGCCCAGGG - Intronic
1143871377 17:9959328-9959350 TCCCCAGCGCCTCCACCCTCAGG - Intronic
1144562605 17:16333685-16333707 TCCCCACTTCCTCTAGCCTCTGG - Intronic
1145934192 17:28705482-28705504 TCCCCAGTCCCTAGAGCCCCAGG + Intronic
1146399469 17:32491909-32491931 TCCCCAGGCCCTGCACCCTGCGG + Intergenic
1146597584 17:34183723-34183745 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1147331456 17:39701526-39701548 TCCCCAGACCCTCTGACCTATGG - Intronic
1148331503 17:46816753-46816775 TCCTCAGTCCCTGCCACCTATGG + Intronic
1148440878 17:47711107-47711129 ACCCCAGTTCCTCCATCCTGTGG + Exonic
1148741462 17:49895331-49895353 GCCCCAGTCCCTCCACCTTAGGG - Intergenic
1149431159 17:56596251-56596273 TCCCCAGCACCTCCGGCCGAGGG - Intergenic
1149567693 17:57651655-57651677 TCCCAAGTGCCTCCTGCCTGTGG + Intronic
1149649350 17:58267328-58267350 GCCTCAGTCTCTCCACCCTAGGG + Exonic
1151622208 17:75253153-75253175 TCCTCAGACCCACCAGCCCAAGG + Intronic
1151658803 17:75508058-75508080 TGCCCCCTCCCTCCAGCCCAGGG + Intronic
1152016058 17:77750962-77750984 TCCCAGGTTGCTCCAGCCTAAGG - Intergenic
1152145660 17:78567242-78567264 TCCCCAGCTCCTCCTGCCTGGGG - Intronic
1152339073 17:79714561-79714583 CCCCCCGTCCCTCCAGCCCATGG + Intergenic
1152528101 17:80901085-80901107 TCCGCAGTCCCTCTTGCCTGTGG - Intronic
1152594035 17:81229559-81229581 TCCTCAGTCCCTCCACCCAGAGG + Intronic
1154938355 18:21085081-21085103 TTCCCTGTCCCTCCAGCCTATGG - Intronic
1154957516 18:21273805-21273827 TGTCCTGTCCCTCCAGCCGATGG - Intronic
1155323877 18:24646706-24646728 CTCCCTGCCCCTCCAGCCTAAGG - Intergenic
1156924315 18:42557569-42557591 TCCTCAGACCCACCAGCCCAAGG - Intergenic
1157545221 18:48541456-48541478 TTCCCAGTTCCTCCTGCCCAGGG + Intronic
1161089105 19:2351418-2351440 TCCTCTGTCCCCACAGCCTATGG + Exonic
1161317487 19:3624474-3624496 TCCCCACTCCCTCCAGACCTTGG - Intronic
1163234474 19:16022800-16022822 TCCCCCAGCCCTCCAGCCCAGGG + Intergenic
1163388619 19:17015794-17015816 CTCCCTGTCCCTCCAGCATACGG - Intronic
1163851988 19:19669297-19669319 TCCCCAGTTCCTCCTCCCTTAGG + Intronic
1164258537 19:23550003-23550025 TCCTCAGTCCAACCAGCCTAAGG + Intronic
1165500392 19:36184625-36184647 TCCCTATTCCCTCCAGCCCCTGG + Intronic
1166042653 19:40213070-40213092 CCCCCAGCCCCTTCAGCCTGCGG - Exonic
1166682903 19:44778918-44778940 GCCCCAGCCCCTCCTTCCTAAGG + Intronic
1167630882 19:50625677-50625699 CCCCCAGTCCCTCCTTCCTCAGG + Intronic
1167738306 19:51310683-51310705 TCCCCAGCCCCTCCTCCCTCAGG - Intergenic
1168228263 19:55011895-55011917 TCCTCAGACCCACCAGCCCAAGG - Intergenic
1168263045 19:55207559-55207581 CCCCCAGGCCCTCCACCCTCAGG - Intronic
1168297634 19:55385125-55385147 CCACCTGTGCCTCCAGCCTATGG - Intergenic
1168666203 19:58207021-58207043 TCACCAGTGGCTACAGCCTAAGG + Exonic
925918727 2:8625041-8625063 ACCCCAGCCCCTCCAGCCTCTGG - Intergenic
926138801 2:10356345-10356367 TCCCCAGTCCCTCAGGCAAAAGG - Intronic
927104675 2:19812953-19812975 TCACCAGACCCTCCTCCCTAAGG + Intergenic
927645308 2:24873528-24873550 TCTGCAGTCCCTACAGCCTGTGG - Intronic
927753563 2:25690769-25690791 GCCACTGTCCCTCCAGCCTCCGG - Intergenic
928779983 2:34806189-34806211 TCCTCAGACCCACCAGCCCAAGG - Intergenic
929272953 2:39993741-39993763 TCCCCAACCACTCCAGCCTGTGG - Intergenic
929457163 2:42074215-42074237 TCCTCACCCCCTCCAGCCTGAGG - Intergenic
932656936 2:73618467-73618489 TCCCCAGTACCTCCACTCCATGG - Intergenic
933059337 2:77717196-77717218 TCCTTTGTCCCTCCATCCTAGGG + Intergenic
933737852 2:85509640-85509662 TCCCCACTCCCCCCAGCCCTTGG - Intergenic
934562690 2:95321112-95321134 TCCCCAGTCCCCCAAGCCTAGGG + Intronic
935272560 2:101447766-101447788 TCCCTATTCTCTCCAGCCTCTGG + Intronic
936175691 2:110218432-110218454 TCCTCAGACCCACCAGCCCAAGG + Intergenic
936475491 2:112836006-112836028 TTACAAGTCCCTCCAGCCTTGGG - Intronic
937879143 2:126851997-126852019 CCACCAGTCCATCCAGCCTTGGG + Intergenic
938848819 2:135239233-135239255 TCCCCTTCCCCTCCAGCCTCTGG - Intronic
940529894 2:154867826-154867848 TCCTCAGACCCACCAGCCCAAGG + Intergenic
940676098 2:156725304-156725326 TCCTCAGACCCACCAGCCCAAGG - Intergenic
941688794 2:168476678-168476700 ACCCCAGGCTCTCCAGCCTTGGG - Intronic
943460401 2:188165778-188165800 TCCTCAGACCCACCAGCCCAAGG - Intergenic
943951564 2:194136021-194136043 TCCTCAGACCCACCAGCCCAAGG - Intergenic
944427019 2:199594412-199594434 TCCTCTGTCCCTCCAATCTAGGG - Intergenic
945173160 2:207017729-207017751 TCCTCAGACCCACCAGCCCAAGG + Intergenic
945301771 2:208221407-208221429 TCCTCAGACCCACCAGCCCAAGG - Intergenic
945360841 2:208894268-208894290 TCCTCAGACCCACCAGCCCAAGG + Intergenic
945506124 2:210642387-210642409 TCACCAGTCAGTCCAGGCTAAGG - Intronic
945901413 2:215541855-215541877 TCCCCAGTTCCACCTGGCTAGGG + Intergenic
946814212 2:223558982-223559004 TTCCCACCCCCTCCAGCCTCTGG - Intergenic
948390350 2:237607297-237607319 TCCTCAGACCCACCAGCCCAAGG + Intergenic
948823017 2:240559643-240559665 TTCCCACTTCCTCCACCCTAAGG - Intronic
1169066614 20:2697600-2697622 TCCCCATTGCCTCCAGTTTAAGG - Intronic
1169275464 20:4230847-4230869 CCCCCAGTCCCTGCAGCCCCAGG + Intronic
1171305531 20:24102638-24102660 TCCCCAGCCCATCCTGCCCATGG + Intergenic
1171976035 20:31595260-31595282 TCCCCAGGCCCTCCCTCCTAAGG - Intergenic
1172869731 20:38128727-38128749 TCCCCAATTCTTCCAGCCCAAGG + Exonic
1172932812 20:38598264-38598286 TCCTCAGACCCACCAGCCCAAGG - Intergenic
1173188932 20:40861647-40861669 TCCGCAGGCCCCCCAGCCCAGGG - Intergenic
1173653730 20:44684501-44684523 TCCCCAGTGCCTACCACCTAAGG - Intergenic
1177119275 21:17121993-17122015 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1177840957 21:26232954-26232976 TCCTCAGACCCACCAGCCCAAGG - Intergenic
1178098665 21:29242322-29242344 TCCCCAGTGCCTCTTGCTTAGGG - Intronic
1179168607 21:38955268-38955290 TCCCCATTCCCTACAGCCCCTGG - Intergenic
1179264635 21:39792376-39792398 TCCCCCTTCCCCCCACCCTATGG - Intronic
1179324669 21:40329876-40329898 TCCCCAGTAACTCCAGCCCTTGG - Intronic
1179654598 21:42837563-42837585 TCCCCAGTCCCTGCAGCCCAAGG + Intergenic
1179919498 21:44499870-44499892 CTCCCAGTCCCTGCAGCCGACGG + Exonic
1180088007 21:45516700-45516722 TCTCCAGTCCCTCCTGCCCCTGG - Intronic
1180154254 21:45970567-45970589 CACCCAGTCCCTGCAGCCAAGGG + Intergenic
1180848801 22:18999993-19000015 TCACCAGTCCCACAATCCTAGGG - Intergenic
1181161536 22:20962831-20962853 TCCCCACTCCCCTCACCCTAGGG - Intergenic
1181659832 22:24337413-24337435 TCCACTGTCCCGCCAGCGTATGG - Intronic
1181971565 22:26694529-26694551 TTCCCTGTCCCTCCAACCTCTGG + Intergenic
1182356932 22:29726386-29726408 TCCCCTGTCCCCCGAGACTAGGG + Intronic
1182516534 22:30862176-30862198 GACCCAGCCCCTCCAGGCTAGGG - Intronic
1182914794 22:34019470-34019492 TCACCTGTCCCTCCGGCTTAAGG - Intergenic
1183174012 22:36209218-36209240 TCCCCAGTCCATACACCCGATGG - Intergenic
1183346579 22:37311550-37311572 TTCCCAGTGGCTCCAGCCTCGGG - Intronic
1183672843 22:39283284-39283306 CCCCCACTCCATCCAGCCTGGGG + Intergenic
1183779652 22:39990572-39990594 TCCCCAGGCCTTCCACCCTCCGG - Intergenic
1184408404 22:44313070-44313092 TCCCCACGCACTCCAGCCTCTGG + Intergenic
1184676353 22:46045332-46045354 TCCTCCTTCCCTCCAGCCAAAGG - Intergenic
949827146 3:8177543-8177565 TCCTCAGACCCACCAGCCCAAGG + Intergenic
950144760 3:10641022-10641044 ACCCCAATCCCTCCTGCCTGGGG - Intronic
950527484 3:13532882-13532904 TCCCCAATGTCTCCAGCCTCAGG - Intergenic
951299097 3:20972696-20972718 TCCTCAGACCCACCAGCCCAAGG - Intergenic
952048031 3:29347663-29347685 TCCAAACTCCCTCCAGACTATGG - Intronic
952203728 3:31158109-31158131 TCAACAGTCCCTCCAGTCCAGGG + Intergenic
952343796 3:32466386-32466408 TCCTCAGACCCACCAGCCCAAGG - Intronic
952791748 3:37205938-37205960 TCCTCAGACCAACCAGCCTAAGG + Intergenic
952931185 3:38362073-38362095 TATCCACTCCCTCCAGCCTCTGG + Intronic
953545897 3:43863387-43863409 ACCCCAGTCCCTGCAGCCACAGG - Intergenic
954214148 3:49115185-49115207 TCCCCGCCCCCTCCAGCCAAGGG + Intronic
954730321 3:52655233-52655255 TCCCCATTCCCTCCAGCCCCTGG + Intronic
955481220 3:59392482-59392504 TCCCCACTCCCTCCAACCCTTGG + Intergenic
956320532 3:67991601-67991623 ACCCCAGGCTCTCCAGCCTTTGG + Intergenic
957291362 3:78281735-78281757 TCTCCAGTAACTCCAGCCAAAGG + Intergenic
957403945 3:79752925-79752947 TCCCCACTCCCTACTGCCTCCGG - Intronic
958182090 3:90072769-90072791 TCCTCAGACCCACCAGCCCAAGG - Intergenic
959288651 3:104445219-104445241 TCCTCAGACCCACCAGCGTAAGG - Intergenic
960231797 3:115237096-115237118 TGCCCATTCCCTCCAGCCCCTGG + Intergenic
961142717 3:124568823-124568845 TCCCCATTCCCTCCAGCCCCTGG - Intronic
961373690 3:126448641-126448663 TCCCTAGTCCCTCCAGCCCTAGG - Intronic
962121837 3:132569333-132569355 TCCACATCCCCTCCAGCATATGG - Intronic
962378471 3:134877793-134877815 TCCCCAGGCCCTCCAGGTTATGG - Intronic
962856942 3:139355556-139355578 TCCCCAATCCCTCCAGCCTGAGG + Intronic
963058300 3:141205408-141205430 TCCTCAGACCCACCAGCCCAAGG + Intergenic
963610924 3:147467330-147467352 TCTCCTCTCCCTCCAGCCTCTGG + Intronic
964125780 3:153231987-153232009 TCCTCAGACCCACCAGCCCAAGG - Intergenic
964375545 3:156045217-156045239 TCCTCAGACCCACCAGCCCAAGG - Intronic
964707180 3:159631657-159631679 TCCCCATTCCCTCCAGCCCCTGG - Intronic
965070043 3:163908037-163908059 TCCTCAGACCCACCAGCCCAAGG + Intergenic
965073103 3:163941196-163941218 TCCCCACTCCCCCCACCCCACGG + Intergenic
965578307 3:170241345-170241367 AACCCACTCCCTCCAGCCTCTGG + Intronic
965596300 3:170414766-170414788 TCCCCAGACCATCCAGACAAAGG - Intergenic
965625181 3:170677727-170677749 TCCTCAGACCCACCAGCCCAAGG - Intronic
965640348 3:170823232-170823254 TCCTCAGACCCACCAGCCCAAGG - Intronic
965667283 3:171108827-171108849 TGCTCTGTACCTCCAGCCTAGGG - Intronic
965713093 3:171576888-171576910 TCCTCAGACCCACCAGCCCAAGG + Intergenic
967576147 3:191096183-191096205 TCCCCAGTCCTTCCTTCCAAAGG + Intergenic
968142195 3:196267350-196267372 CCCCCAGTCTCTCCAGCCTCTGG - Intronic
968528323 4:1076234-1076256 TCCCCAGTGCCAGCAGCCTGAGG + Intronic
968582094 4:1399954-1399976 TCCCCACCCCCACCAGCCGATGG - Intergenic
968993110 4:3927949-3927971 TCCTCAGACCCACCAGCCCAAGG + Intergenic
970029479 4:11658744-11658766 TCCTCAGACCCACCAGCCCAAGG - Intergenic
970532466 4:16998300-16998322 TCCTCAGACCCACCAGCCCAAGG + Intergenic
970854334 4:20635445-20635467 TCCTCAGACCCACCAGCCCAAGG - Intergenic
970870244 4:20808701-20808723 TCCTCAATCCATCCAGCGTATGG - Intronic
970946479 4:21698902-21698924 TCCCCATTCCCACCAGTCTCAGG + Intronic
972872661 4:43319657-43319679 TCCTATGTCCCTCCAGCCTAGGG - Intergenic
975258595 4:72269549-72269571 TCCCCACTCCCTCCACCCCATGG - Intergenic
975492723 4:75006286-75006308 TCCCCCCTCCCCCCACCCTACGG + Intronic
976472300 4:85443755-85443777 TCGCCTGTACCTCCAGGCTATGG + Intergenic
976963869 4:91011780-91011802 TGCTCAGTCCCACCATCCTAGGG - Intronic
977009939 4:91624191-91624213 TCCTCAGACCCACCAGCCCAAGG + Intergenic
977609523 4:99017805-99017827 TCCCCAGTGCATCCAGTCTGTGG - Intronic
979054895 4:115980749-115980771 TCCTCAGACCCACCAGCCCAAGG - Intergenic
979202389 4:117993953-117993975 TCCTGAGACCCTCCATCCTAGGG + Intergenic
980003630 4:127516630-127516652 TCCTCAGACCCACCAGCCCAAGG - Intergenic
980112232 4:128646076-128646098 TCCTCAGACCCACCAGCCCAAGG - Intergenic
980659377 4:135837580-135837602 TTCCCATCCCCTCCACCCTAGGG + Intergenic
982397008 4:154924031-154924053 TCCTCAGACCCACCAGCCCAAGG - Intergenic
982497420 4:156108773-156108795 TCCTCAGACCCACCAGCCCAAGG - Intergenic
982535131 4:156600746-156600768 TCCTCAGACCCACCAGCCCAAGG + Intergenic
983452041 4:167923417-167923439 TCCTCAGACCCACCAGCCCAAGG + Intergenic
983948198 4:173609659-173609681 TACCCAGTACCTTCAGCCAAAGG + Intergenic
985390198 4:189484832-189484854 TCCTCAGACCAGCCAGCCTAAGG - Intergenic
985642143 5:1068700-1068722 GCCCCAGACCCCCCAGCCGAAGG + Intronic
986338656 5:6772759-6772781 CCCTCAGTCCCTCCACCCTTCGG + Intergenic
987755499 5:22095163-22095185 TCCTCAGACCCACCAGCCCAAGG + Intronic
990313002 5:54557606-54557628 TCTCCCTTCCCTCCAGCCTGGGG - Intergenic
990895210 5:60692170-60692192 TCCCCACTCCCCTCAGCCTCTGG - Intronic
992203802 5:74410048-74410070 TCCCCAGGCCCTCCTGCCTATGG - Intergenic
992394359 5:76357807-76357829 TCCTCAGACCCACCAGCCCAAGG + Intergenic
992591071 5:78295797-78295819 TCCCCAGTGCCTCCCGTCCAAGG + Intergenic
992661443 5:78965451-78965473 CCCCTAGTCCCTCCAGCCCTAGG - Intronic
993532733 5:89044143-89044165 TCCCCACACCCTCCAGCACATGG + Intergenic
994040700 5:95256523-95256545 TCCTCTGTTCCTCCAGCCTAGGG + Intronic
995899696 5:117051691-117051713 TCCTCAGACCCGCCAGCCCAAGG - Intergenic
996096332 5:119402789-119402811 TCCCCACTCCTTTCAGCTTAAGG + Intergenic
996363367 5:122675038-122675060 TCCCCTTTCCCTCCAGCCCCTGG + Intergenic
996509619 5:124304272-124304294 TCCTCAGACCCACCAGCCCAAGG + Intergenic
996676969 5:126187339-126187361 TTCCCCCTCCCTCCAGCCTCTGG - Intergenic
997853074 5:137349958-137349980 TCCCCCTTCCCTCCACGCTATGG - Intronic
998294432 5:140953425-140953447 TCCCTAGTTTCTCCAGCTTAAGG - Intronic
998651737 5:144128314-144128336 TCCACATTCCCTCCAACCTTTGG - Intergenic
998910903 5:146959302-146959324 TCCCCAGTCCCTGAAGCTTCAGG - Intronic
999201570 5:149820427-149820449 TCCCCGGACCCTCCACCCTGAGG - Exonic
999343208 5:150791407-150791429 TCCCCCGACCTTCCAGCCTCTGG + Intronic
1000438292 5:161240477-161240499 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1000439422 5:161248921-161248943 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1000935951 5:167303147-167303169 TCCTCAGACCCACCAGCCCAAGG - Intronic
1001144212 5:169169901-169169923 TGGCCAGTCCCTGCAGCCTCTGG - Intronic
1001279960 5:170379592-170379614 TCACCACTCCCTCCAGGCAATGG + Intronic
1001331781 5:170767332-170767354 TCCTCAGACCCACCAGCCCAAGG - Intronic
1002334549 5:178468910-178468932 TCCCCACTCCCCCCAGCCTGTGG + Intronic
1005630315 6:27701118-27701140 TCCCCTCTCCCTTCAGCCTCTGG + Intergenic
1006020044 6:31112448-31112470 CCTCCAGTCCCTCCTGCCCAAGG + Intronic
1006304975 6:33213389-33213411 GCCCCTGTCCCCCCAGCCTCAGG - Intergenic
1009274226 6:61654731-61654753 TCCTGTGTCCCTCCAGCTTAGGG - Intergenic
1009554791 6:65148966-65148988 TCCCCACTCCGTGCAGCCTCAGG - Intronic
1010296643 6:74206512-74206534 TCACCAGTCCATCCAGCCAGAGG + Intergenic
1010894885 6:81350605-81350627 TCCTCAGACCCACCAGCCTAAGG - Intergenic
1011063743 6:83301043-83301065 TCCCCACTCCCCCCATCCCATGG - Intronic
1011501041 6:87990186-87990208 TCCCCCATCCCTGCAGCCTTTGG - Intergenic
1011571623 6:88743492-88743514 TCCCCACTCCCTCCAGCCCCTGG + Intronic
1012674851 6:102102634-102102656 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1014794320 6:125707190-125707212 TCCTCAGACCCACCAGCCCAAGG - Intergenic
1017166035 6:151409246-151409268 TCCCCTGTTTCACCAGCCTAGGG + Intronic
1017651840 6:156590675-156590697 GACCCAGTCCCTCCAGCAGAGGG - Intergenic
1018432205 6:163731056-163731078 TCACCATCCCCTCCAGCCCAGGG - Intergenic
1019647693 7:2139793-2139815 TCCCCCGACCCTCAAGGCTAAGG + Intronic
1020315752 7:6904302-6904324 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1020728053 7:11841816-11841838 TCCCCAGTGGCTCCAGGCTCTGG - Intergenic
1021375363 7:19900694-19900716 TCCCCTGTCCCTCCCCCCCATGG + Intergenic
1021588854 7:22239281-22239303 TCCCTAGGCCTTCCAGCCCATGG + Intronic
1021637040 7:22703888-22703910 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1022936780 7:35186367-35186389 TCCCCAGCGCCTGCAGCCTTCGG + Intergenic
1024673035 7:51613853-51613875 TCCCCCATTCCTCCAGTCTAAGG + Intergenic
1026388726 7:69878264-69878286 TCCCCGCTCCCTCCACCTTAGGG - Intronic
1027054937 7:75043364-75043386 TCCCAACTCCCTCCAGTCAATGG + Intronic
1029250640 7:99233709-99233731 CCCCCTGTCCCTCCAGGCAATGG - Intergenic
1029608712 7:101615235-101615257 TCCCCAGACCCTGGATCCTATGG + Intronic
1030688361 7:112508798-112508820 CCTCCATTCCCTGCAGCCTATGG - Intergenic
1031530524 7:122870453-122870475 CTCCCACTCCCTCCAGCCTCTGG - Intronic
1031685589 7:124729656-124729678 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1031777037 7:125918072-125918094 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1031855244 7:126914765-126914787 GCCCCACTCCCTCCATCCTTGGG - Intronic
1031862781 7:127000701-127000723 TCCTCATTCCCTCCAGCCCCTGG - Intronic
1032023254 7:128421723-128421745 TCCCCAGGCCCTCCTGCCCTAGG + Intergenic
1032963159 7:137064002-137064024 TCCCCAGTCCCTCCACCCTCTGG - Intergenic
1034494040 7:151409755-151409777 TCCCCGCTGCCTCCAGCCTCTGG + Intronic
1035425902 7:158772928-158772950 TCCAGGGTCTCTCCAGCCTATGG - Intronic
1035576280 8:708629-708651 TCCCCACTCCCTCTAGCCTCTGG - Intronic
1036071207 8:5441775-5441797 TCCTCAGACCCACCAGCCCAAGG - Intergenic
1036472643 8:9064670-9064692 TCCTCAGACCCACCAGCCCAAGG - Intronic
1038444015 8:27590740-27590762 TCCCCACCACCTCCAGCCTGTGG - Intergenic
1039907911 8:41799654-41799676 TCCCCAGTCCCTCAGGCTTGAGG + Intronic
1041188786 8:55331120-55331142 TCCCCATTGCCTCCAGCCCCTGG + Intronic
1041320831 8:56610905-56610927 TCCCCAGGCCCACCAGCCTGTGG + Intergenic
1042864544 8:73345691-73345713 ACCCCAGTCCCTTCAGCATGCGG - Intergenic
1043130517 8:76455307-76455329 TCCCCAATCCATCTAGTCTATGG - Intergenic
1043197634 8:77317858-77317880 TCCCCAGTTACTCCAGCCTCTGG + Intergenic
1043617365 8:82143577-82143599 TCCCCCTTCCCCCCACCCTACGG + Intergenic
1045286180 8:100793609-100793631 TACCCTCTCCCTCCAGCCTCTGG + Intergenic
1045288403 8:100811462-100811484 TCCCCGCTCCCTCCACCCTGAGG - Intergenic
1046085305 8:109427045-109427067 TTCCCATTCCCTCCAGACTCTGG - Exonic
1047016444 8:120728480-120728502 TCCCCACTCCCTCCCTCCCACGG + Intronic
1047219697 8:122909689-122909711 TCCACATTCACTCCAGCCTCCGG + Intronic
1047437909 8:124850294-124850316 TCCCCCCTCCCTCCAGTCTCTGG + Intergenic
1047856096 8:128914970-128914992 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1047873445 8:129110049-129110071 TTCCCATTGCCTCCAGCATATGG + Intergenic
1047971069 8:130085120-130085142 TCCCCTGGCCCTCCATCCTTTGG - Intronic
1049495715 8:142931253-142931275 ACCCCAGGCTCTCCAGCCTTTGG - Intergenic
1049661747 8:143822613-143822635 TCCCCAGGCCCACCTGGCTAGGG - Intronic
1049693125 8:143971446-143971468 CCCACAGTCCCTCCACCCCAGGG + Intronic
1050256019 9:3792976-3792998 TCCCCACTCCCACCAGCCTATGG - Intergenic
1052162891 9:25288693-25288715 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1052191537 9:25669431-25669453 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1052387204 9:27835970-27835992 TCATCAGTCCCTCTAGCCGATGG - Intergenic
1052653019 9:31326856-31326878 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1052968164 9:34358152-34358174 TCCCCATTCCTCCCAGCCTCTGG + Intergenic
1053057682 9:35003806-35003828 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1057350210 9:94290405-94290427 TCCCCACTCCCCCCAGCCCCTGG + Intronic
1058026525 9:100145991-100146013 TCCTCAGACCCACCAGCCCAAGG - Intronic
1058448497 9:105074636-105074658 TTCCCTCTCCCTCCAGCCTCTGG - Intergenic
1058877730 9:109258961-109258983 TCCTCAGGCCCTCCATCCTGTGG - Intronic
1059498487 9:114730534-114730556 TCACCAGTCCCTCCTTCCTTTGG + Intergenic
1060100424 9:120835771-120835793 TTCCCCGTTCCTCCAGCCTCTGG - Intronic
1060269595 9:122131355-122131377 TCCCCAGTGCCTCCAGGTGAAGG + Intergenic
1060521444 9:124296319-124296341 TCCTCTGTGCCTCCAGCCGAGGG - Intronic
1060522919 9:124304092-124304114 CCCCCAGTCCCACCAGCATCTGG + Intronic
1060889327 9:127178063-127178085 TCCCCATGCCCTTTAGCCTAGGG - Intronic
1061073452 9:128326349-128326371 TCTCCAGCCCCTCCAGCCCCAGG + Intronic
1061197433 9:129114774-129114796 CCCACAGTCTCTCCAGCCTCAGG - Intronic
1061198394 9:129121459-129121481 TCAACAGTCCCTTCAGCCTAGGG + Intronic
1061238044 9:129353292-129353314 TCCCCAGTCCCTCCTGGAGAGGG - Intergenic
1061843630 9:133375304-133375326 TCCCCACTCAATCCAGCCCAGGG + Intronic
1062179097 9:135181109-135181131 CACCCTGTCCCTCCAGCCCACGG - Intergenic
1186260073 X:7768107-7768129 TCCCCACTCCCTCCACCCTGGGG - Intergenic
1186477926 X:9873114-9873136 TTTCCAATCCCTCCAGCCTCTGG - Intronic
1186670203 X:11759154-11759176 GCCCCTGTCCCTGCCGCCTAAGG - Intronic
1186990463 X:15061621-15061643 TCCTCTGTGCTTCCAGCCTACGG - Intergenic
1187300473 X:18044318-18044340 TCCCCAGTCATTGCAGCCTGAGG - Intergenic
1187322545 X:18253116-18253138 TCCCCAGTCTTTCAAGGCTAAGG + Intronic
1187512072 X:19928910-19928932 TTCTCAATCCCTCCAGCCTCTGG - Intronic
1187771206 X:22698945-22698967 TCCCCATTCTCTCCAGACCAAGG - Intergenic
1188333270 X:28897584-28897606 TCCTCAGACCCACCAGCCCAAGG - Intronic
1189901170 X:45707842-45707864 TCCCCACTCCTCCCAGCCTCTGG - Intergenic
1190211828 X:48455008-48455030 TCCCCACTCCGCCCAGCCTTTGG - Intergenic
1191222395 X:58003274-58003296 CCCCCAGTTGCTCCATCCTAGGG - Intergenic
1192409130 X:70916932-70916954 TCCCCACTCCCTCCAGCCTCTGG + Intergenic
1194366814 X:93023470-93023492 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1194660386 X:96624506-96624528 TCCTCAGACCCACCAGCCCAAGG + Intergenic
1194874102 X:99164663-99164685 TCCTCAGACCCACCAGCCCAAGG - Intergenic
1195454331 X:105051272-105051294 CCCCCAGTCCCTGCAGGCTCGGG - Intronic
1195871781 X:109493928-109493950 CCCTCAGTCCTTCCAGCCTAAGG - Intergenic
1196221269 X:113113860-113113882 TCCTCAGACCCACCAGCCCAAGG - Intergenic
1196238422 X:113310153-113310175 TCCCCTCTTCCTCAAGCCTAAGG + Intergenic
1197758216 X:130010756-130010778 TCCCCAGTCACCCTAGCCAAAGG - Intronic
1197788596 X:130226403-130226425 TTCCCAGTCCCACCACCCTTAGG + Intronic
1198079731 X:133228010-133228032 TCCCCAGTCCATCCTCCCAAGGG + Intergenic
1198446552 X:136723131-136723153 TTCCCATTCCCTCCAGCCCTTGG - Intronic
1198457450 X:136830692-136830714 TCTCCACTCCCTTAAGCCTAAGG + Intergenic
1198799551 X:140434605-140434627 CCCTTTGTCCCTCCAGCCTATGG + Intergenic
1198935519 X:141899542-141899564 TCCCCACTCCTCCCAGCCTGAGG + Intergenic
1199875712 X:151926382-151926404 TTCCCATTCCCCCCAGCCTGAGG + Intergenic
1200223263 X:154402631-154402653 TCCCCCGTCCATCCAGCCCTGGG - Exonic
1200328353 X:155266063-155266085 TCCCATGTTCCTCCAGCCTTTGG + Intergenic
1200675036 Y:6139726-6139748 TCCTCAGACCCACCAGCCCAAGG + Intergenic