ID: 1087725931

View in Genome Browser
Species Human (GRCh38)
Location 11:101716578-101716600
Sequence CCCTTCAGGCCCTATTTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087725926_1087725931 9 Left 1087725926 11:101716546-101716568 CCTTCTCTTCTACTCTGCGTCAT 0: 1
1: 0
2: 0
3: 17
4: 258
Right 1087725931 11:101716578-101716600 CCCTTCAGGCCCTATTTTACAGG 0: 1
1: 0
2: 1
3: 15
4: 210
1087725924_1087725931 15 Left 1087725924 11:101716540-101716562 CCTCTCCCTTCTCTTCTACTCTG 0: 1
1: 0
2: 10
3: 117
4: 1291
Right 1087725931 11:101716578-101716600 CCCTTCAGGCCCTATTTTACAGG 0: 1
1: 0
2: 1
3: 15
4: 210
1087725925_1087725931 10 Left 1087725925 11:101716545-101716567 CCCTTCTCTTCTACTCTGCGTCA 0: 1
1: 0
2: 1
3: 28
4: 280
Right 1087725931 11:101716578-101716600 CCCTTCAGGCCCTATTTTACAGG 0: 1
1: 0
2: 1
3: 15
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087725931 Original CRISPR CCCTTCAGGCCCTATTTTAC AGG Intronic
900965354 1:5953608-5953630 CCGTTCAGGCTGTATTTTGCTGG - Intronic
903406045 1:23097142-23097164 TCCCTCAGGCCCTTTTTTAAAGG + Intronic
911242867 1:95484009-95484031 CGCTTCAGGCCCTATTCATCTGG - Intergenic
911359362 1:96858469-96858491 CACTCCAGACCCTATTTTCCTGG + Intergenic
912210511 1:107551825-107551847 CCCTTCAGGCCTTCTTAGACTGG + Intergenic
912517708 1:110226501-110226523 GCCTTCAGGCCCCATTCCACAGG + Intronic
912607665 1:111008575-111008597 CACTTCAGGCCCTATTCATCTGG - Intergenic
913246363 1:116873691-116873713 CCCTTCAGGCCCTCTTATAAGGG + Intergenic
914404709 1:147358810-147358832 CACTTCAGGCCCTATTCATCTGG - Intergenic
915711437 1:157902683-157902705 CACTTCAGACCCTGTTTTCCTGG - Intergenic
915982201 1:160427241-160427263 CCATCCAGGCCCTGTTTTCCAGG - Exonic
917356341 1:174130755-174130777 CACTTCAGGCCCTATTCATCTGG + Intergenic
918168834 1:181975672-181975694 CACTTCAGGCCCTATTCATCTGG - Intergenic
919031713 1:192251435-192251457 CACTTCAGGCCCTATTCATCTGG + Intergenic
919657175 1:200208580-200208602 TTCTTCCAGCCCTATTTTACTGG - Intergenic
919869823 1:201811895-201811917 CCCTACAGTCCCTATATTATAGG + Exonic
923942510 1:238844032-238844054 CACTTCAGGCCCTATTCATCTGG + Intergenic
924118423 1:240771287-240771309 CCCTTCACTCCCTTCTTTACTGG + Intergenic
1063182500 10:3617380-3617402 CCTTTCAGGCCCTCTTCCACTGG - Intergenic
1067212047 10:44267426-44267448 CCCTCCAGACCCTGTTTTCCTGG - Intergenic
1069371036 10:67747472-67747494 CACTTCAGGCCCTATTCACCTGG - Intergenic
1072044987 10:91645011-91645033 CACTCCAGACCCTATTTGACTGG - Intergenic
1078691340 11:13583168-13583190 CACTTCAGGCCCTATTCATCTGG - Intergenic
1079935159 11:26608226-26608248 CCCTTCAGGCCCTATTCATTTGG + Intronic
1079981648 11:27157515-27157537 CACTTCAGACCCTGTTTTCCTGG + Intergenic
1080130801 11:28792588-28792610 CCCTTCAGGACCTATTCATCTGG + Intergenic
1081875758 11:46407442-46407464 ATCTTCAGGCCCTTTTTTGCAGG - Intronic
1087725931 11:101716578-101716600 CCCTTCAGGCCCTATTTTACAGG + Intronic
1088383293 11:109220985-109221007 CACTTCAGGCCCTATTCATCTGG + Intergenic
1091798389 12:3309943-3309965 GCATTCAGGCCCTACTTTTCAGG - Intergenic
1093303399 12:17479967-17479989 CACTTCAGGCCCTATTCATCTGG - Intergenic
1094275426 12:28669274-28669296 CACTTCAAGCCCTATTCAACTGG - Intergenic
1096957880 12:55545643-55545665 CCCTCCAGACCCTGTTTTCCTGG + Intergenic
1097529436 12:60780450-60780472 CACTTCAGGCCCTATTCATCTGG + Intergenic
1100598430 12:96091491-96091513 CCCTTGAGGCCCTGTGTTTCTGG + Intergenic
1101066629 12:101028030-101028052 CACTTTAGGCCCTATTTATCTGG - Intronic
1101471949 12:105005739-105005761 GCCTCCAGGCCCTATTCTCCTGG + Intronic
1102208515 12:111107107-111107129 CACTTCTGTCCCCATTTTACAGG + Intronic
1102417564 12:112777571-112777593 CCCTTCAGCCCCTACTTCAGAGG - Intronic
1105981328 13:25519207-25519229 TCCTTCAGGGCCTAGTTCACAGG + Intronic
1108113577 13:47103371-47103393 CTCTTCAGGCCCTATTCATCTGG - Intergenic
1109307824 13:60661034-60661056 CACTTCAGGCCCTATTCATCTGG + Intergenic
1110836834 13:80093378-80093400 CACTTCAGGCCCTAATTATCTGG + Intergenic
1111305745 13:86410215-86410237 CACTTCAGGCCCTATTCATCTGG - Intergenic
1113527804 13:110994417-110994439 CACTTCAGGCCCTATTCATCTGG - Intergenic
1114245740 14:20911455-20911477 CCCTCCAGACCCTGTTTTCCTGG - Intergenic
1115294587 14:31811913-31811935 CACTTCAGACCCTGTTTTCCTGG + Intronic
1115343723 14:32319502-32319524 CAATTCAGGACCTGTTTTACTGG - Intergenic
1116808440 14:49516199-49516221 CCCCTGAAGCCCCATTTTACAGG + Intergenic
1118740918 14:68738616-68738638 CCCTTGAGACCCTGTTTGACAGG + Intergenic
1119342739 14:73894314-73894336 CCTTTTAGTCCCTATTTCACTGG - Intronic
1124046437 15:26155290-26155312 CCCTTCAGGCCCTATTCATCTGG + Intergenic
1126284495 15:46996092-46996114 CACTTCAGGCCCTATTCATCTGG + Intergenic
1127042451 15:54991435-54991457 CACTTCAGGCCCTATTCACCTGG - Intergenic
1127868760 15:63052950-63052972 CTCTGCAGGCCCTATTATACTGG - Intronic
1127971112 15:63962614-63962636 CACTCCAGACCCTGTTTTACTGG + Intronic
1130722678 15:86404937-86404959 CCCTTAAGGGCCCATTTTTCAGG - Intronic
1130848370 15:87768417-87768439 CACTTCAGGCCCTATTCATCTGG - Intergenic
1134077088 16:11299689-11299711 CCCTGAAGGCCCCACTTTACAGG + Intronic
1141083646 16:81076190-81076212 GTCTTCAGGACCTATTTAACTGG - Intronic
1142625951 17:1192086-1192108 CCCTTCAGTTCCTATATTCCAGG + Intronic
1144431873 17:15199415-15199437 CACTTCAGACCCTATTTGCCTGG - Intergenic
1148602031 17:48901480-48901502 CCCTTCAGGCCCTGACTTGCAGG + Intergenic
1149377848 17:56064031-56064053 CACTTCAGGCCCTATTCATCTGG + Intergenic
1150196412 17:63304368-63304390 CACTTCAGGCCCTATTCATCTGG + Intronic
1155468635 18:26167534-26167556 CCCTACAGGCCCTATTTTTGGGG - Intronic
1158729071 18:60003284-60003306 CACTTCAGGCCCTATTCATCTGG + Intergenic
1163949568 19:20571450-20571472 CACTTCAGGCCCTATTCATCCGG + Intronic
1163968507 19:20770448-20770470 CACTTCAGGCCCTATTAATCTGG - Intronic
1164134986 19:22406330-22406352 CACTTCAGGCCCTATTTACGTGG - Intronic
1164163768 19:22650206-22650228 CACTTCAGGCCCTATTTATCTGG + Intronic
1164349953 19:27324806-27324828 CACTCCAGACCCTATTTTTCTGG - Intergenic
1164645479 19:29856187-29856209 CCCTCCACGCTCTATTTTAAAGG - Intergenic
1166075584 19:40412099-40412121 CCCTTCTGGCCCTCTTTCCCTGG + Intronic
1166722134 19:45002690-45002712 CCCTCCAGGCCCAACTTTAAGGG + Intronic
1166904828 19:46101005-46101027 CACTTCAGGCCCTATTCACCTGG + Intergenic
925988586 2:9235549-9235571 CCCTTCACTCCCTAATGTACTGG - Intronic
928578929 2:32685439-32685461 CCCTTCTGGCCCACTGTTACTGG + Intronic
934811007 2:97276380-97276402 CACTTCAAGCCCTATTTATCTGG - Intergenic
934826685 2:97431559-97431581 CACTTCAAGCCCTATTTATCTGG + Intergenic
935177888 2:100665133-100665155 CCCTGCTGGTCCTGTTTTACTGG + Intergenic
936696075 2:114949762-114949784 CCCATCAGACCCCATTGTACTGG - Intronic
936778027 2:115997434-115997456 TCCTTCAGGCTTTATTTTTCTGG + Intergenic
937684349 2:124679456-124679478 CCCTTTAATCTCTATTTTACAGG + Intronic
944035598 2:195290871-195290893 CACTCCAGACCCTATTTTCCTGG - Intergenic
945657490 2:212643255-212643277 CCCTTCAGTGCCGATTTTGCTGG + Intergenic
948131203 2:235601819-235601841 CCCAGCAGGCCCTGTTTTTCTGG + Intronic
948419591 2:237848719-237848741 CCCTCCAGGCCCTGTTTGCCTGG + Intergenic
1169695672 20:8384815-8384837 CACTTCAGGCCCTATTCATCTGG + Intronic
1169979139 20:11364108-11364130 CACTTCAGGCCCTATTCATCTGG + Intergenic
1170678020 20:18500142-18500164 GCCTCCAGACCCTATTTTCCTGG - Intergenic
1170730078 20:18966279-18966301 CACTTCAGGCCCTATTCACCTGG - Intergenic
1171009805 20:21502999-21503021 GACTTCAGGGCCTATTTTAATGG - Intergenic
1171353866 20:24528612-24528634 CCCCTCAAGCCCTTTTGTACAGG + Intronic
1172584184 20:36071031-36071053 CCCTTCTGTCCCTACTTCACTGG + Intergenic
1172654124 20:36526459-36526481 GGCTTCAGGTCCCATTTTACAGG - Intronic
1173395855 20:42678622-42678644 CCATTCATGCCCTACTTTAAGGG + Intronic
1174973654 20:55306079-55306101 CACTTCAGGCCCTATTCAACTGG - Intergenic
1176636025 21:9195320-9195342 CCATTGAGGCCTTATCTTACAGG - Intergenic
1177127373 21:17212273-17212295 TCCTTCAAGCCCTTTTTTAATGG - Intergenic
1177881341 21:26698605-26698627 CTCTGGAGGCCCTATTCTACGGG + Intergenic
1180619693 22:17152783-17152805 CACTCCAGTCCCTGTTTTACTGG - Intronic
1182995302 22:34806783-34806805 CTCTTCAGACCCTTTTTTCCAGG - Intergenic
1184094837 22:42310986-42311008 CCCTCCAGGCCGTATTTTCTTGG - Intronic
1184386668 22:44180505-44180527 CCGTGCAGGACCTATTTTGCTGG - Intronic
1184603736 22:45559666-45559688 TCCTTAAGCCCCTATTTAACTGG + Intronic
951137343 3:19118775-19118797 CACTTCAGGCCCTATTCATCTGG - Intergenic
953115546 3:39989318-39989340 CGCTTCAGGCCCTATTCATCTGG + Intronic
953509937 3:43525316-43525338 CACTTCAGGCTCCATTTTACTGG + Intronic
954986952 3:54802938-54802960 CACTTCAGACCCTGTTTGACTGG - Intronic
955832023 3:63015170-63015192 CACTTCAGGCCCTATTTGTCTGG + Intergenic
956866402 3:73373723-73373745 CACTCCAGACCCTATTTTCCTGG + Intergenic
958162306 3:89832579-89832601 CACTCCAGACCCTATTTTCCTGG - Intergenic
958423114 3:93950560-93950582 CACTCCAGGCCCTATTTTCCTGG - Intronic
958495318 3:94836903-94836925 CACTCCAGACCCTATTTTCCTGG - Intergenic
958711733 3:97724978-97725000 GCTTGCAGGCCCTATTTTTCAGG + Intronic
959763918 3:110001658-110001680 CACTGCAGACCCTATTTTCCTGG + Intergenic
962717714 3:138141558-138141580 GCCTTCATGCACTATTATACTGG - Intergenic
964007665 3:151851556-151851578 CACTTCAGGCCCTATTCACCTGG + Intergenic
964950985 3:162292741-162292763 CTATTCAGGCCCTTTTTTTCAGG + Intergenic
966789895 3:183657570-183657592 CCCTTCATTCCATATTTTGCAGG + Intronic
969918465 4:10513332-10513354 CCCTTCTGGCTATATGTTACTGG - Intronic
971906531 4:32732907-32732929 CACTTCAGGCCCTATTCATCTGG - Intergenic
972219415 4:36936465-36936487 CACTCCAGACCCTATTTTCCTGG - Intergenic
973584761 4:52378413-52378435 CACTTCAGGCCCTATTGGTCTGG - Intergenic
974210257 4:58763838-58763860 CCCTGCAGGCTCTATTTTGTTGG - Intergenic
974499806 4:62684689-62684711 CACTTCAGGCCCTATTCATCTGG - Intergenic
974885316 4:67810223-67810245 CACTTCAGGCCCTATTCATCTGG - Intergenic
976026757 4:80697249-80697271 CCTTTAAGGCCTTATTTAACAGG - Intronic
977060671 4:92254327-92254349 CACTTCAGGCCCTATTCACCTGG + Intergenic
977461527 4:97331983-97332005 CCATTCAGTGCCTATTTAACAGG + Intronic
978494097 4:109340432-109340454 CACTTCAGGCCCTGTTTGCCTGG - Intergenic
979468269 4:121066456-121066478 TCAATCAGGCCCTATTATACTGG + Intronic
981187125 4:141816509-141816531 CACTTCAGGCCCTATTCACCTGG - Intergenic
981202080 4:141992303-141992325 CGCTCCAGGCCCTGTTTTCCTGG + Intergenic
981237641 4:142436613-142436635 CACTTCAGGCCCTATTCATCTGG - Intronic
981352923 4:143752888-143752910 CTCTTCAGGCCCTATTCATCTGG - Intergenic
984092206 4:175387918-175387940 CGCTTCAGGCCCTATTCATCTGG - Intergenic
986110460 5:4710495-4710517 CACTCCAGGCCCTGTTTTCCTGG - Intergenic
988076491 5:26362046-26362068 CACTTCAGGCCCTATTTACCTGG + Intergenic
989348121 5:40453200-40453222 CACTTCAGGCCCTATTTATTTGG + Intergenic
990071675 5:51790414-51790436 CACTCCAGACCCTATTTTCCTGG + Intergenic
992254777 5:74911057-74911079 CTCTTCAGACCCTATTTGCCTGG + Intergenic
993587239 5:89746508-89746530 CACTTCAGGCCCTATTCATCTGG + Intergenic
995661176 5:114484928-114484950 CCCTCGAGGCCTTATGTTACAGG - Intronic
995960058 5:117829225-117829247 CACTTCAGGCCCTATTCATCAGG + Intergenic
996004502 5:118404801-118404823 CACTCCAGGCCCTATTCCACTGG + Intergenic
996273321 5:121635563-121635585 GCCTCCAGGCCCTATTCTACTGG - Intergenic
996527178 5:124491824-124491846 CACTTCAGGCCCTATTCATCTGG + Intergenic
996639180 5:125731122-125731144 CACTTCAGGCCCTATTCATCTGG - Intergenic
997067608 5:130580454-130580476 CACTTCAGGCCCTATTCATCTGG - Intergenic
998788928 5:145744559-145744581 CACTTCAGGCCCTATTCATCTGG - Intronic
999111328 5:149123738-149123760 CACTTCAGACCCTGTTTTCCTGG - Intergenic
999243177 5:150139073-150139095 CCCTTCAGGCTCTCTTCTGCTGG + Intronic
1001739031 5:174034868-174034890 CACTTCAGGCCCTATTCATCTGG + Intergenic
1004760209 6:18657234-18657256 CACTTCAGGCCCTATTCATCTGG - Intergenic
1005393925 6:25362145-25362167 CCCCTCAGGCCAGATATTACTGG + Intronic
1005670384 6:28099572-28099594 CACTTCAGGCCCTATTCGCCTGG - Intergenic
1006030249 6:31172417-31172439 CCCTTCAGGGTCTGTTTTTCTGG + Intronic
1006175966 6:32121767-32121789 CTCTTCTGGCCCTAGATTACAGG + Intronic
1006407457 6:33853449-33853471 ACCGTCAGGCCCTATCTTAGAGG - Intergenic
1007679782 6:43626144-43626166 CCCCTCAGGCCCTAGGTAACTGG + Intronic
1009916687 6:70005444-70005466 CACTTCAGGCCCTATTCATCTGG + Intronic
1010282887 6:74041107-74041129 CACTTCAGGCCCTATTCACCTGG + Intergenic
1012741070 6:103017813-103017835 CACTTCAGGCCCTATTCATCTGG + Intergenic
1013241912 6:108254171-108254193 CCATTCAGGTTCTCTTTTACTGG - Intronic
1014064753 6:117111395-117111417 CACTTCAGGCCCTATTCATCTGG - Intergenic
1014140782 6:117939626-117939648 CCCTTTAGGTCCTTTTTAACTGG - Intronic
1014411557 6:121128945-121128967 CCCTTCAGCCTCTATTATAAGGG - Intronic
1014422403 6:121261482-121261504 CACTTCAGGCCCTATTCATCTGG - Intronic
1015136912 6:129882760-129882782 CACTTCAGGCCCTATTCATCTGG + Intergenic
1016663573 6:146609610-146609632 CCCTTAAGGACCTCTTTTAAAGG + Intronic
1017065804 6:150527984-150528006 CCCTGCTGTCTCTATTTTACAGG - Intergenic
1018975587 6:168562839-168562861 CCCTCCAGGCCGTATTTTCACGG + Intronic
1022096746 7:27145941-27145963 CCCTCCAGGCCCTGGCTTACCGG - Intronic
1023135975 7:37052456-37052478 CCCTTAAGGCCCTCTTTCTCAGG + Intronic
1023207280 7:37764118-37764140 CACTTCAGGCCCTATTCATCAGG - Intronic
1026935889 7:74255011-74255033 GCCTTGAGTCCCTATTTTCCTGG - Intergenic
1027559495 7:79709820-79709842 GCCTGCAGGCCATAGTTTACTGG - Intergenic
1029669090 7:102016411-102016433 GCCTTCCGGCCCTGTTTTAGGGG - Intronic
1032526765 7:132583714-132583736 TCCTTCTGGCCCTATTTTCCTGG + Intronic
1032638927 7:133743272-133743294 TCAATCAGGCCCTATTTTTCTGG - Intronic
1033879192 7:145860684-145860706 CACTTCAGGCCCTATTCATCTGG - Intergenic
1037694969 8:21215552-21215574 CCCCTCTTACCCTATTTTACAGG - Intergenic
1039658295 8:39433880-39433902 CACTTCAGGCCCTATTCATCTGG - Intergenic
1040614093 8:49017836-49017858 CATTTCAGGCCCTATTTATCTGG + Intergenic
1041021297 8:53642006-53642028 CACTTCAGGCCCTATTCATCTGG + Intergenic
1041286263 8:56265571-56265593 CACTTCAGACCCTGTTTTCCTGG + Intergenic
1041743179 8:61177691-61177713 CCCTTCTGTCCCTATTCTTCTGG - Intronic
1042449315 8:68925929-68925951 CCCTCCAGGCCCTCCTTTTCAGG + Intergenic
1042759765 8:72257687-72257709 CTCTTCAGGCCCTATTTATCTGG - Intergenic
1046338804 8:112825620-112825642 CACTTCAGGCCCTATTCATCTGG + Intronic
1046708934 8:117487513-117487535 CACTTCAGGCCTTATTCTTCTGG - Intergenic
1047152011 8:122274223-122274245 CACTTCAGGCCCTATTAACCTGG - Intergenic
1050660839 9:7880727-7880749 CACTTCAGGCCCTATTCATCTGG - Intronic
1050778667 9:9302236-9302258 TCCTTCTGGCCCTATCTGACAGG + Intronic
1052199843 9:25764420-25764442 CACTTCAGGCCCTATTCATCTGG - Intergenic
1052717049 9:32129336-32129358 CACTTCAGGCCCTATTCATCTGG - Intergenic
1052826172 9:33176962-33176984 ACCTTAAGGCCCCATTTTACGGG + Intergenic
1055417002 9:76094314-76094336 CCTTCCAGGCCCTAATTTTCTGG - Intronic
1058626789 9:106941924-106941946 CCATTCAAGGCCTAATTTACAGG - Intronic
1059895231 9:118856452-118856474 CACTTCAGGCCCTATTCATCTGG - Intergenic
1185952581 X:4452487-4452509 CACTTCAGGCCCTATTCATCTGG - Intergenic
1188957787 X:36454164-36454186 CGCTCCAAGCCCTATTTTAGTGG + Intergenic
1191023581 X:55889256-55889278 CACTCCAGGCCCTCTTTGACTGG + Intergenic
1191225092 X:58034643-58034665 CACTTCAGTCCCTATTCTCCTGG + Intergenic
1191775437 X:64808229-64808251 CACTTCAGGCCCTATTCATCCGG - Intergenic
1192571384 X:72209047-72209069 CCTCTCTGGCCTTATTTTACTGG + Intronic
1192716534 X:73648059-73648081 CACTTCAGGCCCTATTCATCTGG - Intronic
1192915957 X:75651761-75651783 CCCTTCAGACCCTGTTTGCCTGG + Intergenic
1193072407 X:77319745-77319767 CACTTCAGGCCCTGTTTGCCTGG - Intergenic
1193365069 X:80622694-80622716 CACTTCAGGCCCTATTCATCTGG + Intergenic
1193770718 X:85584027-85584049 CACTCCAGACCCTGTTTTACTGG - Intergenic
1194286885 X:92020903-92020925 CACTTCAGGCCCTATTCATCTGG - Intronic
1194523231 X:94943443-94943465 CACTTCAGGCCCTATTCATCTGG - Intergenic
1194852060 X:98881649-98881671 CACTTCAGGCCCTATTCATCTGG - Intergenic
1194973397 X:100368769-100368791 TCCTTCAGGCCCTCTTATCCAGG - Intronic
1195153519 X:102097920-102097942 CACTTCAGGCCCTATTCACCTGG - Intergenic
1195527051 X:105902974-105902996 CCCTTCAGTCCCTAGTTTCTGGG + Intronic
1195729173 X:107948744-107948766 CACTCCAGGCCCTGTTTTCCTGG + Intergenic
1197049464 X:122042001-122042023 CCCTTCAGGCCCTATTCATCTGG + Intergenic
1198420959 X:136470459-136470481 CCCTTCAGGGCCTCTTTTACAGG + Intergenic
1199564352 X:149198959-149198981 CACTCCAGACCCTATTTTCCTGG + Intergenic
1200604427 Y:5245463-5245485 CACTTCAGGCCCTATTCATCTGG - Intronic
1201619997 Y:15946221-15946243 CACTCCAGGCCCTGTTTTCCTGG + Intergenic
1201956846 Y:19634122-19634144 CACTCCAGACCCTATTTTCCTGG + Intergenic
1202150360 Y:21838575-21838597 CCCATCACGGCCTATTTTTCAGG - Intergenic