ID: 1087729047

View in Genome Browser
Species Human (GRCh38)
Location 11:101757934-101757956
Sequence CCATGTATGTAGAAGCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 115}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087729047_1087729050 12 Left 1087729047 11:101757934-101757956 CCATCATGCTTCTACATACATGG 0: 1
1: 0
2: 1
3: 4
4: 115
Right 1087729050 11:101757969-101757991 ATGGCCAAGAAGCTCCTCCCAGG 0: 1
1: 2
2: 3
3: 25
4: 222
1087729047_1087729055 18 Left 1087729047 11:101757934-101757956 CCATCATGCTTCTACATACATGG 0: 1
1: 0
2: 1
3: 4
4: 115
Right 1087729055 11:101757975-101757997 AAGAAGCTCCTCCCAGGGTGGGG 0: 1
1: 0
2: 5
3: 41
4: 269
1087729047_1087729049 -7 Left 1087729047 11:101757934-101757956 CCATCATGCTTCTACATACATGG 0: 1
1: 0
2: 1
3: 4
4: 115
Right 1087729049 11:101757950-101757972 TACATGGTATCAATAGCAAATGG 0: 1
1: 0
2: 2
3: 7
4: 180
1087729047_1087729054 17 Left 1087729047 11:101757934-101757956 CCATCATGCTTCTACATACATGG 0: 1
1: 0
2: 1
3: 4
4: 115
Right 1087729054 11:101757974-101757996 CAAGAAGCTCCTCCCAGGGTGGG 0: 1
1: 0
2: 1
3: 21
4: 218
1087729047_1087729053 16 Left 1087729047 11:101757934-101757956 CCATCATGCTTCTACATACATGG 0: 1
1: 0
2: 1
3: 4
4: 115
Right 1087729053 11:101757973-101757995 CCAAGAAGCTCCTCCCAGGGTGG 0: 1
1: 0
2: 0
3: 17
4: 191
1087729047_1087729051 13 Left 1087729047 11:101757934-101757956 CCATCATGCTTCTACATACATGG 0: 1
1: 0
2: 1
3: 4
4: 115
Right 1087729051 11:101757970-101757992 TGGCCAAGAAGCTCCTCCCAGGG 0: 1
1: 0
2: 2
3: 28
4: 203
1087729047_1087729059 30 Left 1087729047 11:101757934-101757956 CCATCATGCTTCTACATACATGG 0: 1
1: 0
2: 1
3: 4
4: 115
Right 1087729059 11:101757987-101758009 CCAGGGTGGGGTTTTTAGTATGG 0: 1
1: 1
2: 4
3: 24
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087729047 Original CRISPR CCATGTATGTAGAAGCATGA TGG (reversed) Intronic
901780542 1:11591536-11591558 CCATGTATGTGATAGCATCATGG - Intergenic
904245277 1:29183001-29183023 CCATGTACCTAGAACCATAAAGG + Intergenic
905325292 1:37147566-37147588 CCATGTATGTGGGAGCAGGGAGG - Intergenic
907017858 1:51034771-51034793 CCATGTATGGAGAAGGAATAGGG - Intergenic
907257312 1:53189703-53189725 CCAGGTAGGCAGAAGCAAGAAGG + Intergenic
907782001 1:57575339-57575361 CAATGTATGCAGAAGCATTTTGG - Intronic
908208460 1:61874697-61874719 ACATGTATATAAAAGCAAGATGG + Intronic
909702194 1:78538302-78538324 CCATTTATTTAGAAGCCTCAAGG - Exonic
1065454542 10:25893220-25893242 CCATATATCTAGAAGGACGATGG + Intergenic
1066800973 10:39189930-39189952 CCATTTTTGTAGAATCACGAAGG - Intergenic
1068703354 10:60044539-60044561 TCAAGTATGTATAAGCGTGATGG + Intronic
1068839053 10:61589865-61589887 CCTTTTATGTACAATCATGATGG - Intergenic
1074078743 10:110151615-110151637 CCATCCATGTAGAAGGAAGAGGG - Intergenic
1078886669 11:15507245-15507267 CCAAGTATGCAGTAGCATCATGG - Intergenic
1079476793 11:20839513-20839535 TCATGTATATAGAAAGATGAAGG + Intronic
1079652789 11:22950801-22950823 CAATGTATGAAAAAGCATGAGGG - Intergenic
1084733619 11:71090387-71090409 CCCTGAATGTAGAAGCAGCAGGG - Intronic
1086659630 11:89398966-89398988 TCATGTATGCAGAAGCATATGGG + Intronic
1087729047 11:101757934-101757956 CCATGTATGTAGAAGCATGATGG - Intronic
1094346265 12:29472618-29472640 ACATGTATGTGGAACAATGAGGG + Intronic
1102251092 12:111388062-111388084 CCATGTGTGAAGAGGCTTGAGGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1107284139 13:38770809-38770831 CCAGGACTGTAGAAGTATGACGG - Intronic
1108106618 13:47017439-47017461 CCATGTATGTATATGACTGATGG - Intergenic
1108995344 13:56725957-56725979 TAATGTATGAAGAAGAATGATGG + Intergenic
1111294751 13:86264156-86264178 CCTTGTGTGTGGAAGGATGAGGG + Intergenic
1111550862 13:89810245-89810267 CCATATATGTATATGCATGTGGG + Intergenic
1116178291 14:41501925-41501947 CCTTGTATATATAAGAATGAAGG + Intergenic
1118231455 14:63954292-63954314 CCCTGTATGTAGAAGTTTAAAGG + Intronic
1119830079 14:77694266-77694288 GAATGAATGTTGAAGCATGAAGG + Intronic
1120295826 14:82639196-82639218 CCAAGAATGAAGAAGCATTATGG - Intergenic
1120960272 14:90118186-90118208 ACACATATGTAGAAGCATGATGG - Intronic
1126787992 15:52194397-52194419 CCATGAATGAAGAAGAAAGATGG - Intronic
1133072057 16:3253293-3253315 CGATGTAGGAAGAAGCATGCTGG + Intronic
1133686980 16:8174771-8174793 TCAAGTATGTAGAAGGAGGATGG - Intergenic
1135123996 16:19791583-19791605 CCTTGTGTGTGGAAGGATGAGGG - Intronic
1136506398 16:30706761-30706783 CCTTGTATCTAGAATCAAGAGGG + Intronic
1140696874 16:77543421-77543443 CCCTGTCTGTAGAAGGAGGAAGG + Intergenic
1141029993 16:80579262-80579284 CCATGTGGGTAGAACCAAGATGG + Intergenic
1142739928 17:1925941-1925963 CCCTGTAGGAAGAAGGATGATGG + Intergenic
1144145440 17:12393395-12393417 CCATGTATGTGAAACCATGTTGG + Intergenic
1146367681 17:32241962-32241984 CCCTGAAAGTAGAAGCATGCTGG - Intronic
1149080152 17:52646066-52646088 CCATATATACAGAAACATGAAGG + Intergenic
1151216198 17:72578203-72578225 CCATGTATGTGGAACCATCATGG + Intergenic
1153082469 18:1243828-1243850 TCCTGAATGTAGAAGCAAGAGGG - Intergenic
1155005640 18:21726799-21726821 GTATCTATGTAGAAGCATGTGGG - Intronic
1160469832 18:79120168-79120190 CAATGTATGTATAAAGATGATGG - Intronic
1166411534 19:42558611-42558633 CCACGTGTGTAGAACCATCAAGG + Intronic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
928673558 2:33627559-33627581 GCATGTTTGTAGCTGCATGATGG + Intergenic
931390733 2:61841370-61841392 CCATGTATGCAAAGGCAAGATGG - Intronic
931853872 2:66281370-66281392 CATTGAATGTAGCAGCATGAAGG - Intergenic
938070036 2:128303552-128303574 CCATGTATGGAGGAGCATCTGGG - Intronic
938605997 2:132893568-132893590 CTTTGTATGTAGAATCATGTTGG - Intronic
945523442 2:210858709-210858731 CTATGTGTGAAGAAGGATGACGG - Intergenic
945806540 2:214497457-214497479 CCATATATGAAGAAGGATCATGG - Intronic
946567873 2:220987448-220987470 TAATGTAGGTAGAAGCATGCTGG + Intergenic
947283937 2:228489051-228489073 CCACGTATGTATAAAAATGATGG + Intergenic
948972511 2:241440376-241440398 CCTTGTGTGTGGAACCATGAGGG + Intronic
1169369911 20:5020784-5020806 CCATGTTTGGTGAAGCATCAGGG + Intergenic
1173186211 20:40842530-40842552 CCATGTATGAAACAGCAGGAAGG - Intergenic
1173231373 20:41201522-41201544 CCATGTATGTCAAAGAAGGAAGG + Intronic
1174324631 20:49769393-49769415 CCATGAATGATGCAGCATGAAGG - Intergenic
1175693798 20:61086015-61086037 TCATGTTTGTAGAAGCTGGAGGG - Intergenic
1179286594 21:39983106-39983128 GCATGTATGGAGAAACATGTAGG - Intergenic
949949112 3:9214654-9214676 CCATGGATGGAGAAGCTGGAAGG + Intronic
955419914 3:58725721-58725743 CAATGTATGAAGAAGCACGATGG - Intronic
956246867 3:67193125-67193147 CCTTGTAGGAAGAAGCTTGAGGG - Intergenic
957175629 3:76804291-76804313 CCATCTATGTGAAACCATGAAGG + Intronic
959688153 3:109170094-109170116 CTATGTATGGAGAAGCACCAGGG + Intergenic
961555926 3:127696714-127696736 ACATGAATGAAGAAGCATCATGG - Intronic
962049453 3:131797343-131797365 CCATGATTTTTGAAGCATGAAGG + Intronic
963021367 3:140875567-140875589 CCAGGTATGTATAACCATAAAGG + Intergenic
963140958 3:141945832-141945854 CCATGTCTGTCGAATCATAACGG - Intergenic
963385794 3:144592313-144592335 TCATGAATGTAGAAGCATATTGG + Intergenic
966050296 3:175608556-175608578 CAAAGTCTGTGGAAGCATGAAGG - Intronic
967373313 3:188772912-188772934 CTATGTATGTATAAGAAGGAAGG + Intronic
967716577 3:192769244-192769266 CCATATATGTAGATGCATCTAGG + Intergenic
967948483 3:194822665-194822687 CCAAGCATGAAGAAGCAAGAGGG - Intergenic
969502379 4:7560949-7560971 CCATGGCTGCAGAAGCAAGATGG + Intronic
970481114 4:16476174-16476196 CCATTTATGTGGGAGCTTGAAGG + Intergenic
970710581 4:18857545-18857567 GCATGAATGTTGACGCATGATGG + Intergenic
974121960 4:57649649-57649671 CCATGAATGAAGCAGCAGGAAGG - Intergenic
975215327 4:71746983-71747005 CCAAGAATGTAGAAGAATGTGGG + Intronic
981014448 4:139959326-139959348 CCATGGATGCAGAATCAAGACGG - Intronic
982116344 4:152101476-152101498 CCCTGTAGGTAGAAGCATATGGG + Intergenic
987656407 5:20813957-20813979 CCATGTATATCAAAGCATCAGGG + Intergenic
988141840 5:27253256-27253278 CAATGTTTGTGGAAGAATGAGGG - Intergenic
988767150 5:34389988-34390010 CCATGTATATCAAAGCATCAGGG - Intergenic
990350991 5:54915954-54915976 CCGTTTCTGTAGGAGCATGATGG - Intergenic
990703629 5:58502306-58502328 CTGTGTATGTAGCAGCAAGAAGG + Intergenic
992133710 5:73721184-73721206 CCATGTATGAGGAAGGATGGGGG + Intronic
997553481 5:134774262-134774284 GCATGTATGTTGTAGCATGTTGG + Intronic
1001835149 5:174825276-174825298 ACATGGAGGAAGAAGCATGAAGG - Intergenic
1003162448 6:3647741-3647763 ACATTTATTTAGAAACATGAAGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1011958953 6:93062215-93062237 CAATATATGTATAGGCATGAAGG - Intergenic
1018023268 6:159783088-159783110 GGATGTATGAAGAAGCTTGAAGG + Intronic
1022857336 7:34328221-34328243 CCATATTTGTAGACGGATGATGG + Intergenic
1023681148 7:42688711-42688733 TCAAGTAGGTAGAAGCAGGAAGG + Intergenic
1024428873 7:49262394-49262416 CCATGTAGGTAACAGCATTAAGG + Intergenic
1028158850 7:87463521-87463543 CCAAGTATGCAGAACCTTGAAGG + Intronic
1030123033 7:106129266-106129288 CCCTCTATGTAGCAGCAAGATGG - Intergenic
1034717738 7:153259130-153259152 CTAAGTTTGTAGAAGTATGAGGG - Intergenic
1035618160 8:1017706-1017728 CCAGGGCTGTAGAAGCAGGACGG + Intergenic
1043333547 8:79146346-79146368 CAAGGTATGTAGAAGCATGATGG - Intergenic
1044605498 8:94043897-94043919 CCATTTATGTTGAAGCTAGAGGG - Intergenic
1044626910 8:94242907-94242929 TCACGTATTTAGAAGCAAGATGG + Intergenic
1048486825 8:134856107-134856129 ACATTTATTGAGAAGCATGAAGG + Intergenic
1058031348 9:100201434-100201456 CCAGATATGCAGAAACATGATGG + Intronic
1061592398 9:131606334-131606356 CCATGATGGTAGCAGCATGATGG - Intronic
1186867672 X:13736336-13736358 CCATGGATCTAGAACCATTATGG + Intronic
1187245528 X:17550118-17550140 GCTTGTATGTATAAGCAAGATGG - Intronic
1189103797 X:38216993-38217015 CTATGTATGTAGATTCATGGTGG + Intronic
1194178487 X:90683810-90683832 CCATGTGTGGAGAAGTATGTGGG - Intergenic
1195758198 X:108220064-108220086 CCTTATCTGTAGAAGCATAATGG - Intronic
1198711113 X:139505329-139505351 CCAGGTATATTGCAGCATGACGG + Intergenic
1199441447 X:147872845-147872867 CTATCTATCTAGAAGAATGAAGG - Intergenic
1200525151 Y:4265975-4265997 CCATGTGTGGAGAAGTATGTGGG - Intergenic
1201850125 Y:18471100-18471122 CCATGGATCTAGAAACATTATGG - Intergenic
1201883193 Y:18849277-18849299 CCATGGATCTAGAAACATTATGG + Intergenic